\
| Variant ID: vg1124072046 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 24072046 |
| Reference Allele: G | Alternative Allele: GGGATGA,A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.78, A: 0.22, others allele: 0.00, population size: 182. )
ATCTGAATCTTGCAGTCATCAATGTCCATGAAAGTCCGAAAGATTCCCTGAATAACTTTTTCACCGGGCATTCCCTGAATAACTTCCTCAATGGCGGATG[G/GGGATGA,A]
TACATGTTTTGTTGGATGTAACAGAGTGGAAATTCCAAAGTTTCTGAGCTTGCATATATTATCTGCAGTGAAGTGGACGTTTCTTGGTTTAAGGTCACCG
CGGTGACCTTAAACCAAGAAACGTCCACTTCACTGCAGATAATATATGCAAGCTCAGAAACTTTGGAATTTCCACTCTGTTACATCCAACAAAACATGTA[C/TCATCCC,T]
CATCCGCCATTGAGGAAGTTATTCAGGGAATGCCCGGTGAAAAAGTTATTCAGGGAATCTTTCGGACTTTCATGGACATTGATGACTGCAAGATTCAGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 37.00% | 18.30% | 0.51% | 31.42% | GGGATGA: 12.72% |
| All Indica | 2759 | 12.00% | 23.50% | 0.72% | 45.81% | GGGATGA: 17.94% |
| All Japonica | 1512 | 78.80% | 7.70% | 0.20% | 12.63% | GGGATGA: 0.66% |
| Aus | 269 | 46.50% | 21.60% | 0.00% | 1.12% | GGGATGA: 30.86% |
| Indica I | 595 | 5.70% | 2.90% | 0.67% | 69.75% | GGGATGA: 21.01% |
| Indica II | 465 | 6.00% | 22.80% | 0.65% | 64.73% | GGGATGA: 5.81% |
| Indica III | 913 | 17.50% | 37.30% | 0.33% | 22.34% | GGGATGA: 22.45% |
| Indica Intermediate | 786 | 14.00% | 23.40% | 1.27% | 43.77% | GGGATGA: 17.56% |
| Temperate Japonica | 767 | 87.40% | 5.30% | 0.26% | 6.00% | GGGATGA: 1.04% |
| Tropical Japonica | 504 | 80.80% | 5.20% | 0.20% | 13.69% | GGGATGA: 0.20% |
| Japonica Intermediate | 241 | 47.70% | 20.30% | 0.00% | 31.54% | GGGATGA: 0.41% |
| VI/Aromatic | 96 | 61.50% | 25.00% | 0.00% | 7.29% | GGGATGA: 6.25% |
| Intermediate | 90 | 45.60% | 23.30% | 1.11% | 22.22% | GGGATGA: 7.78% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1124072046 | G -> DEL | LOC_Os11g40380.1 | N | frameshift_variant | Average:37.166; most accessible tissue: Callus, score: 86.372 | N | N | N | N |
| vg1124072046 | G -> A | LOC_Os11g40380.1 | missense_variant ; p.Pro567Ser; MODERATE | nonsynonymous_codon ; P567S | Average:37.166; most accessible tissue: Callus, score: 86.372 | unknown | unknown | TOLERATED | 0.31 |
| vg1124072046 | G -> GGGATGA | LOC_Os11g40380.1 | inframe_insertion ; p.Val566_Pro567insSerSer; MODERATE | inframe_variant | Average:37.166; most accessible tissue: Callus, score: 86.372 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1124072046 | NA | 4.22E-15 | mr1162_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | NA | 1.33E-08 | mr1321_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | NA | 2.53E-06 | mr1428_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | NA | 6.50E-06 | mr1452_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | NA | 3.88E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | NA | 2.70E-08 | mr1654_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | 1.65E-06 | NA | mr1918_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1124072046 | 7.68E-06 | NA | mr1961_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |