\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124043769:

Variant ID: vg1124043769 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24043769
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.75, A: 0.24, others allele: 0.00, population size: 72. )

Flanking Sequence (100 bp) in Reference Genome:


CTTCCATTTGGATTTATTGGATCTTTATTTGAATTTTAACCGAATTCAAATCGTTTCTTCGCACGTAATTTTAGAGCCCGAGGGAGTTACGGATCCAAGC[A/G]
AGGACCAAGAACCGCAAGACTTTGAGCAAGGCAAGTCATCACTATTCCTTGAACATGTTGATCCCAATTGCGAAATTGTTTTGTTTACAAATAAAATTGC

Reverse complement sequence

GCAATTTTATTTGTAAACAAAACAATTTCGCAATTGGGATCAACATGTTCAAGGAATAGTGATGACTTGCCTTGCTCAAAGTCTTGCGGTTCTTGGTCCT[T/C]
GCTTGGATCCGTAACTCCCTCGGGCTCTAAAATTACGTGCGAAGAAACGATTTGAATTCGGTTAAAATTCAAATAAAGATCCAATAAATCCAAATGGAAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 31.00% 7.10% 54.85% 7.00% NA
All Indica  2759 12.40% 11.70% 73.14% 2.75% NA
All Japonica  1512 58.80% 0.40% 24.54% 16.27% NA
Aus  269 46.10% 1.50% 50.93% 1.49% NA
Indica I  595 20.50% 3.40% 72.10% 4.03% NA
Indica II  465 8.80% 7.30% 81.72% 2.15% NA
Indica III  913 6.70% 19.80% 70.87% 2.63% NA
Indica Intermediate  786 15.10% 11.10% 71.50% 2.29% NA
Temperate Japonica  767 69.00% 0.00% 20.73% 10.30% NA
Tropical Japonica  504 53.40% 0.80% 30.56% 15.28% NA
Japonica Intermediate  241 37.80% 0.80% 24.07% 37.34% NA
VI/Aromatic  96 75.00% 0.00% 22.92% 2.08% NA
Intermediate  90 43.30% 4.40% 48.89% 3.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124043769 A -> DEL N N silent_mutation Average:7.707; most accessible tissue: Callus, score: 15.861 N N N N
vg1124043769 A -> G LOC_Os11g40330.1 upstream_gene_variant ; 1157.0bp to feature; MODIFIER silent_mutation Average:7.707; most accessible tissue: Callus, score: 15.861 N N N N
vg1124043769 A -> G LOC_Os11g40320.1 downstream_gene_variant ; 4175.0bp to feature; MODIFIER silent_mutation Average:7.707; most accessible tissue: Callus, score: 15.861 N N N N
vg1124043769 A -> G LOC_Os11g40340.1 downstream_gene_variant ; 2630.0bp to feature; MODIFIER silent_mutation Average:7.707; most accessible tissue: Callus, score: 15.861 N N N N
vg1124043769 A -> G LOC_Os11g40330-LOC_Os11g40340 intergenic_region ; MODIFIER silent_mutation Average:7.707; most accessible tissue: Callus, score: 15.861 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124043769 NA 9.92E-07 mr1517 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124043769 NA 2.70E-07 mr1538 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124043769 NA 2.11E-08 mr1517_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124043769 NA 6.93E-11 mr1538_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251