Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124032771:

Variant ID: vg1124032771 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24032771
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.93, T: 0.05, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

GGTGTTTCCTGTAGCGTAGATTTGTTTGCCAATGCTTTGTGAAAAGTTGTTGTGGTTTGGGAATCGTTACCAGAATCAGCCTATGTGGCAGATGGATGAC[T/C]
TGAGTGGTCAAGGAACGAATCTATGTGATTCGGGATGTCTACGGGCATCATAGACTAGGCTTCCCGAGTGGAAGCAGATTGTTGTGCTGCTGGGCAGCTG

Reverse complement sequence

CAGCTGCCCAGCAGCACAACAATCTGCTTCCACTCGGGAAGCCTAGTCTATGATGCCCGTAGACATCCCGAATCACATAGATTCGTTCCTTGACCACTCA[A/G]
GTCATCCATCTGCCACATAGGCTGATTCTGGTAACGATTCCCAAACCACAACAACTTTTCACAAAGCATTGGCAAACAAATCTACGCTACAGGAAACACC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.50%	11.50%	3.32%	63.65%	NA
All Indica	2759	6.50%	19.00%	4.86%	69.70%	NA
All Japonica	1512	45.00%	0.50%	0.53%	53.97%	NA
Aus	269	45.70%	0.70%	4.46%	49.07%	NA
Indica I	595	10.30%	3.40%	3.70%	82.69%	NA
Indica II	465	6.70%	21.90%	2.58%	68.82%	NA
Indica III	913	1.90%	24.00%	6.46%	67.69%	NA
Indica Intermediate	786	8.90%	23.20%	5.22%	62.72%	NA
Temperate Japonica	767	58.80%	0.40%	0.26%	40.55%	NA
Tropical Japonica	504	36.30%	0.80%	1.19%	61.71%	NA
Japonica Intermediate	241	19.10%	0.40%	0.00%	80.50%	NA
VI/Aromatic	96	7.30%	1.00%	0.00%	91.67%	NA
Intermediate	90	30.00%	12.20%	3.33%	54.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124032771	T -> DEL	N	N	silent_mutation	Average:18.288; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1124032771	T -> C	LOC_Os11g40315.1	5_prime_UTR_variant ; 244.0bp to feature; MODIFIER	silent_mutation	Average:18.288; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1124032771	T -> C	LOC_Os11g40300.1	upstream_gene_variant ; 2447.0bp to feature; MODIFIER	silent_mutation	Average:18.288; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1124032771	T -> C	LOC_Os11g40320.1	upstream_gene_variant ; 4631.0bp to feature; MODIFIER	silent_mutation	Average:18.288; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N
vg1124032771	T -> C	LOC_Os11g40310.1	downstream_gene_variant ; 1006.0bp to feature; MODIFIER	silent_mutation	Average:18.288; most accessible tissue: Minghui63 panicle, score: 59.629	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124032771	7.73E-07	NA	mr1601	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124032771	NA	7.23E-07	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251