Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124031127:

Variant ID: vg1124031127 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 24031127
Reference Allele: G	Alternative Allele: A
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.10, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:

ATAGCCCACCCAGGTGACGTTTCGCCTACCCACCAGTAATAAAGCGCCACGTGTCGCGAGGGTAGGTGAAACAGTAAATTCCCATCGACCAAGTTGCACA[G/A]
TAAAAAGCCACAAAGGGAGGGCCCATTACTGTTCCTTTCGGCCCGGGAAAAATAAAAATAATATACCACCGTCCGCAGGAGGCGAAGAGCGGCAAAACGA

Reverse complement sequence

TCGTTTTGCCGCTCTTCGCCTCCTGCGGACGGTGGTATATTATTTTTATTTTTCCCGGGCCGAAAGGAACAGTAATGGGCCCTCCCTTTGTGGCTTTTTA[C/T]
TGTGCAACTTGGTCGATGGGAATTTACTGTTTCACCTACCCTCGCGACACGTGGCGCTTTATTACTGGTGGGTAGGCGAAACGTCACCTGGGTGGGCTAT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	46.80%	20.50%	7.38%	25.33%	NA
All Indica	2759	71.30%	5.50%	10.87%	12.32%	NA
All Japonica	1512	4.00%	44.60%	1.79%	49.60%	NA
Aus	269	53.90%	39.40%	1.86%	4.83%	NA
Indica I	595	81.20%	9.90%	3.19%	5.71%	NA
Indica II	465	68.80%	6.50%	12.26%	12.47%	NA
Indica III	913	70.50%	1.10%	13.03%	15.33%	NA
Indica Intermediate	786	66.00%	6.90%	13.36%	13.74%	NA
Temperate Japonica	767	5.20%	58.50%	1.43%	34.81%	NA
Tropical Japonica	504	1.00%	35.50%	1.19%	62.30%	NA
Japonica Intermediate	241	6.60%	19.10%	4.15%	70.12%	NA
VI/Aromatic	96	7.30%	9.40%	7.29%	76.04%	NA
Intermediate	90	36.70%	28.90%	11.11%	23.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1124031127	G -> A	LOC_Os11g40300.1	upstream_gene_variant ; 803.0bp to feature; MODIFIER	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1124031127	G -> A	LOC_Os11g40310.1	upstream_gene_variant ; 354.0bp to feature; MODIFIER	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1124031127	G -> A	LOC_Os11g40284.1	downstream_gene_variant ; 4372.0bp to feature; MODIFIER	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1124031127	G -> A	LOC_Os11g40315.1	downstream_gene_variant ; 726.0bp to feature; MODIFIER	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1124031127	G -> A	LOC_Os11g40300-LOC_Os11g40310	intergenic_region ; MODIFIER	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N
vg1124031127	G -> DEL	N	N	silent_mutation	Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1124031127	NA	3.10E-06	mr1092	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	2.45E-06	NA	mr1692	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	NA	1.22E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	NA	4.16E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	NA	2.54E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	4.88E-06	9.88E-08	mr1606_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127	NA	2.48E-21	mr1698_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251