\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1124031127:

Variant ID: vg1124031127 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 24031127
Reference Allele: GAlternative Allele: A
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.88, A: 0.10, others allele: 0.00, population size: 41. )

Flanking Sequence (100 bp) in Reference Genome:


ATAGCCCACCCAGGTGACGTTTCGCCTACCCACCAGTAATAAAGCGCCACGTGTCGCGAGGGTAGGTGAAACAGTAAATTCCCATCGACCAAGTTGCACA[G/A]
TAAAAAGCCACAAAGGGAGGGCCCATTACTGTTCCTTTCGGCCCGGGAAAAATAAAAATAATATACCACCGTCCGCAGGAGGCGAAGAGCGGCAAAACGA

Reverse complement sequence

TCGTTTTGCCGCTCTTCGCCTCCTGCGGACGGTGGTATATTATTTTTATTTTTCCCGGGCCGAAAGGAACAGTAATGGGCCCTCCCTTTGTGGCTTTTTA[C/T]
TGTGCAACTTGGTCGATGGGAATTTACTGTTTCACCTACCCTCGCGACACGTGGCGCTTTATTACTGGTGGGTAGGCGAAACGTCACCTGGGTGGGCTAT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.80% 20.50% 7.38% 25.33% NA
All Indica  2759 71.30% 5.50% 10.87% 12.32% NA
All Japonica  1512 4.00% 44.60% 1.79% 49.60% NA
Aus  269 53.90% 39.40% 1.86% 4.83% NA
Indica I  595 81.20% 9.90% 3.19% 5.71% NA
Indica II  465 68.80% 6.50% 12.26% 12.47% NA
Indica III  913 70.50% 1.10% 13.03% 15.33% NA
Indica Intermediate  786 66.00% 6.90% 13.36% 13.74% NA
Temperate Japonica  767 5.20% 58.50% 1.43% 34.81% NA
Tropical Japonica  504 1.00% 35.50% 1.19% 62.30% NA
Japonica Intermediate  241 6.60% 19.10% 4.15% 70.12% NA
VI/Aromatic  96 7.30% 9.40% 7.29% 76.04% NA
Intermediate  90 36.70% 28.90% 11.11% 23.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1124031127 G -> A LOC_Os11g40300.1 upstream_gene_variant ; 803.0bp to feature; MODIFIER silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1124031127 G -> A LOC_Os11g40310.1 upstream_gene_variant ; 354.0bp to feature; MODIFIER silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1124031127 G -> A LOC_Os11g40284.1 downstream_gene_variant ; 4372.0bp to feature; MODIFIER silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1124031127 G -> A LOC_Os11g40315.1 downstream_gene_variant ; 726.0bp to feature; MODIFIER silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1124031127 G -> A LOC_Os11g40300-LOC_Os11g40310 intergenic_region ; MODIFIER silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N
vg1124031127 G -> DEL N N silent_mutation Average:35.14; most accessible tissue: Minghui63 panicle, score: 80.641 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1124031127 NA 3.10E-06 mr1092 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 2.45E-06 NA mr1692 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 NA 1.22E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 NA 4.16E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 NA 2.54E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 4.88E-06 9.88E-08 mr1606_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1124031127 NA 2.48E-21 mr1698_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251