\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123900554:

Variant ID: vg1123900554 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23900554
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CTAGCTTTAAACTCTTGCTAAGTTTCCTCCAAAATTTATATATGAATGTCCATTTCATAGGAATTTCAAAGCATTGGGTATGATTCAATCTTTTGATTCA[A/T]
AGGCATCCATAGAACTTTTTTCTATAGGATTGAAATCTTTCAAAATTCATATGTTTTTCCTCTAAATCAAAAAGGCCCTTAGAGGATTTCAATCCTATAT

Reverse complement sequence

ATATAGGATTGAAATCCTCTAAGGGCCTTTTTGATTTAGAGGAAAAACATATGAATTTTGAAAGATTTCAATCCTATAGAAAAAAGTTCTATGGATGCCT[T/A]
TGAATCAAAAGATTGAATCATACCCAATGCTTTGAAATTCCTATGAAATGGACATTCATATATAAATTTTGGAGGAAACTTAGCAAGAGTTTAAAGCTAG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 92.80% 7.00% 0.19% 0.00% NA
All Indica  2759 99.60% 0.40% 0.07% 0.00% NA
All Japonica  1512 88.00% 11.70% 0.26% 0.00% NA
Aus  269 69.10% 29.70% 1.12% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 100.00% 0.00% 0.00% 0.00% NA
Indica III  913 100.00% 0.00% 0.00% 0.00% NA
Indica Intermediate  786 98.60% 1.30% 0.13% 0.00% NA
Temperate Japonica  767 99.10% 0.80% 0.13% 0.00% NA
Tropical Japonica  504 67.30% 32.30% 0.40% 0.00% NA
Japonica Intermediate  241 96.30% 3.30% 0.41% 0.00% NA
VI/Aromatic  96 43.80% 56.20% 0.00% 0.00% NA
Intermediate  90 91.10% 8.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123900554 A -> T LOC_Os11g40080.1 upstream_gene_variant ; 2058.0bp to feature; MODIFIER silent_mutation Average:34.622; most accessible tissue: Callus, score: 57.732 N N N N
vg1123900554 A -> T LOC_Os11g40070.1 downstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:34.622; most accessible tissue: Callus, score: 57.732 N N N N
vg1123900554 A -> T LOC_Os11g40070.2 downstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:34.622; most accessible tissue: Callus, score: 57.732 N N N N
vg1123900554 A -> T LOC_Os11g40070.3 downstream_gene_variant ; 4415.0bp to feature; MODIFIER silent_mutation Average:34.622; most accessible tissue: Callus, score: 57.732 N N N N
vg1123900554 A -> T LOC_Os11g40070-LOC_Os11g40080 intergenic_region ; MODIFIER silent_mutation Average:34.622; most accessible tissue: Callus, score: 57.732 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123900554 NA 8.90E-07 mr1082 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 8.53E-07 8.53E-07 mr1145 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 6.67E-06 6.67E-06 mr1204 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 NA 5.70E-06 mr1408 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 NA 1.44E-08 mr1570 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 8.09E-06 NA mr1226_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 NA 3.91E-06 mr1226_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123900554 NA 4.70E-06 mr1363_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251