\
| Variant ID: vg1123900554 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23900554 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CTAGCTTTAAACTCTTGCTAAGTTTCCTCCAAAATTTATATATGAATGTCCATTTCATAGGAATTTCAAAGCATTGGGTATGATTCAATCTTTTGATTCA[A/T]
AGGCATCCATAGAACTTTTTTCTATAGGATTGAAATCTTTCAAAATTCATATGTTTTTCCTCTAAATCAAAAAGGCCCTTAGAGGATTTCAATCCTATAT
ATATAGGATTGAAATCCTCTAAGGGCCTTTTTGATTTAGAGGAAAAACATATGAATTTTGAAAGATTTCAATCCTATAGAAAAAAGTTCTATGGATGCCT[T/A]
TGAATCAAAAGATTGAATCATACCCAATGCTTTGAAATTCCTATGAAATGGACATTCATATATAAATTTTGGAGGAAACTTAGCAAGAGTTTAAAGCTAG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.80% | 7.00% | 0.19% | 0.00% | NA |
| All Indica | 2759 | 99.60% | 0.40% | 0.07% | 0.00% | NA |
| All Japonica | 1512 | 88.00% | 11.70% | 0.26% | 0.00% | NA |
| Aus | 269 | 69.10% | 29.70% | 1.12% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.00% | 0.17% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.60% | 1.30% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 99.10% | 0.80% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 67.30% | 32.30% | 0.40% | 0.00% | NA |
| Japonica Intermediate | 241 | 96.30% | 3.30% | 0.41% | 0.00% | NA |
| VI/Aromatic | 96 | 43.80% | 56.20% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 91.10% | 8.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123900554 | A -> T | LOC_Os11g40080.1 | upstream_gene_variant ; 2058.0bp to feature; MODIFIER | silent_mutation | Average:34.622; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1123900554 | A -> T | LOC_Os11g40070.1 | downstream_gene_variant ; 4415.0bp to feature; MODIFIER | silent_mutation | Average:34.622; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1123900554 | A -> T | LOC_Os11g40070.2 | downstream_gene_variant ; 4415.0bp to feature; MODIFIER | silent_mutation | Average:34.622; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1123900554 | A -> T | LOC_Os11g40070.3 | downstream_gene_variant ; 4415.0bp to feature; MODIFIER | silent_mutation | Average:34.622; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| vg1123900554 | A -> T | LOC_Os11g40070-LOC_Os11g40080 | intergenic_region ; MODIFIER | silent_mutation | Average:34.622; most accessible tissue: Callus, score: 57.732 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123900554 | NA | 8.90E-07 | mr1082 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | 8.53E-07 | 8.53E-07 | mr1145 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | 6.67E-06 | 6.67E-06 | mr1204 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | NA | 5.70E-06 | mr1408 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | NA | 1.44E-08 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | 8.09E-06 | NA | mr1226_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | NA | 3.91E-06 | mr1226_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123900554 | NA | 4.70E-06 | mr1363_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |