Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123842547:

Variant ID: vg1123842547 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23842547
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, others allele: 0.00, population size: 100. )

Flanking Sequence (100 bp) in Reference Genome:

ACATGGCCAAGTAATTCATGTTCTACTAACTAGCTCACAAAGCTAACTTTTTCATTAAGATGGATGGTCAGACTAGCTAATTATCGACACCATGAACACA[A/G]
GAACCAAGACCATGCATGCATTATCGATCCATGTGTATTAACTAGTATATAGATAAGAATCAAATACAATCTTGTTAGTTGGATTAGTCAATGGCTCAAT

Reverse complement sequence

ATTGAGCCATTGACTAATCCAACTAACAAGATTGTATTTGATTCTTATCTATATACTAGTTAATACACATGGATCGATAATGCATGCATGGTCTTGGTTC[T/C]
TGTGTTCATGGTGTCGATAATTAGCTAGTCTGACCATCCATCTTAATGAAAAAGTTAGCTTTGTGAGCTAGTTAGTAGAACATGAATTACTTGGCCATGT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	44.50%	30.20%	2.48%	22.92%	NA
All Indica	2759	20.70%	39.50%	3.73%	36.06%	NA
All Japonica	1512	85.80%	11.40%	0.40%	2.45%	NA
Aus	269	35.30%	53.90%	0.74%	10.04%	NA
Indica I	595	28.70%	42.50%	4.03%	24.71%	NA
Indica II	465	11.80%	25.20%	5.81%	57.20%	NA
Indica III	913	16.60%	53.30%	1.86%	28.15%	NA
Indica Intermediate	786	24.70%	29.50%	4.45%	41.35%	NA
Temperate Japonica	767	93.70%	3.70%	0.65%	1.96%	NA
Tropical Japonica	504	81.90%	14.50%	0.00%	3.57%	NA
Japonica Intermediate	241	68.50%	29.50%	0.41%	1.66%	NA
VI/Aromatic	96	91.70%	0.00%	2.08%	6.25%	NA
Intermediate	90	54.40%	21.10%	4.44%	20.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123842547	A -> DEL	N	N	silent_mutation	Average:50.025; most accessible tissue: Callus, score: 87.653	N	N	N	N
vg1123842547	A -> G	LOC_Os11g39990.1	upstream_gene_variant ; 2069.0bp to feature; MODIFIER	silent_mutation	Average:50.025; most accessible tissue: Callus, score: 87.653	N	N	N	N
vg1123842547	A -> G	LOC_Os11g39960-LOC_Os11g39990	intergenic_region ; MODIFIER	silent_mutation	Average:50.025; most accessible tissue: Callus, score: 87.653	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123842547	NA	8.71E-06	mr1117	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	NA	9.65E-21	mr1580	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	5.44E-06	NA	mr1679	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	NA	2.83E-07	mr1690	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	1.59E-07	8.63E-12	mr1693	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	NA	1.93E-07	mr1113_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	NA	8.94E-06	mr1117_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123842547	NA	2.09E-06	mr1496_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251