\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123564224:

Variant ID: vg1123564224 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23564224
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CCGAGTTCGTTAGTACAGGGTACAGATTTCCAACCGGGTACGCGTGGAAAACGGAACGGTCTATTAGCACGTGATTAATTAAGTATTAGCTAATTTTTTT[A/T]
AAAAAAATGGATTGATTTGATTTTTTAAGCAACTTTCGTATAGAAACTTTTTTGCAAAAAAACACACTGTTTAGCAGTTTAAAAAGCATACGCGCGGAAA

Reverse complement sequence

TTTCCGCGCGTATGCTTTTTAAACTGCTAAACAGTGTGTTTTTTTGCAAAAAAGTTTCTATACGAAAGTTGCTTAAAAAATCAAATCAATCCATTTTTTT[T/A]
AAAAAAATTAGCTAATACTTAATTAATCACGTGCTAATAGACCGTTCCGTTTTCCACGCGTACCCGGTTGGAAATCTGTACCCTGTACTAACGAACTCGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 70.50% 16.70% 6.09% 6.67% NA
All Indica  2759 80.80% 2.80% 6.13% 10.26% NA
All Japonica  1512 48.00% 45.50% 4.43% 2.05% NA
Aus  269 84.40% 0.40% 15.24% 0.00% NA
Indica I  595 58.20% 4.70% 2.18% 34.96% NA
Indica II  465 97.00% 0.40% 1.72% 0.86% NA
Indica III  913 80.90% 2.80% 13.36% 2.85% NA
Indica Intermediate  786 88.20% 2.80% 3.31% 5.73% NA
Temperate Japonica  767 59.60% 29.20% 7.17% 4.04% NA
Tropical Japonica  504 30.00% 69.60% 0.40% 0.00% NA
Japonica Intermediate  241 49.00% 46.90% 4.15% 0.00% NA
VI/Aromatic  96 89.60% 6.20% 4.17% 0.00% NA
Intermediate  90 73.30% 17.80% 7.78% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123564224 A -> T LOC_Os11g39550.1 downstream_gene_variant ; 1012.0bp to feature; MODIFIER silent_mutation Average:52.587; most accessible tissue: Callus, score: 95.255 N N N N
vg1123564224 A -> T LOC_Os11g39540-LOC_Os11g39550 intergenic_region ; MODIFIER silent_mutation Average:52.587; most accessible tissue: Callus, score: 95.255 N N N N
vg1123564224 A -> DEL N N silent_mutation Average:52.587; most accessible tissue: Callus, score: 95.255 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123564224 A T 0.0 0.02 0.02 0.01 0.01 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123564224 NA 3.62E-08 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 NA 2.14E-07 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 NA 8.79E-07 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 NA 8.93E-08 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 6.19E-06 NA mr1679_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 4.59E-07 NA mr1720_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123564224 3.14E-06 NA mr1829_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251