\
| Variant ID: vg1123563633 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23563633 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GACTATTTTTATAAGTTTTCTTTGAATTGTGCGCGCTTTAAGTGAATTGGTATAATAATCGGCTATAACTCGTTAAGCAAAGACCGATATGATACTCTAT[T/C]
TCATTATTAAAAAAGATGTGAATCCCACTTAGCCAGGGGCAGCCAGGATTATACCGAAAGTAGAACTTAATCACTAGATTATAAACTCTTTAAACAAATT
AATTTGTTTAAAGAGTTTATAATCTAGTGATTAAGTTCTACTTTCGGTATAATCCTGGCTGCCCCTGGCTAAGTGGGATTCACATCTTTTTTAATAATGA[A/G]
ATAGAGTATCATATCGGTCTTTGCTTAACGAGTTATAGCCGATTATTATACCAATTCACTTAAAGCGCGCACAATTCAAAGAAAACTTATAAAAATAGTC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 88.20% | 3.40% | 0.19% | 8.13% | NA |
| All Indica | 2759 | 90.00% | 0.60% | 0.33% | 9.06% | NA |
| All Japonica | 1512 | 89.60% | 4.90% | 0.00% | 5.49% | NA |
| Aus | 269 | 84.40% | 1.10% | 0.00% | 14.50% | NA |
| Indica I | 595 | 66.90% | 0.00% | 1.01% | 32.10% | NA |
| Indica II | 465 | 98.70% | 0.00% | 0.00% | 1.29% | NA |
| Indica III | 913 | 98.20% | 0.10% | 0.00% | 1.64% | NA |
| Indica Intermediate | 786 | 92.90% | 1.90% | 0.38% | 4.83% | NA |
| Temperate Japonica | 767 | 85.00% | 5.10% | 0.00% | 9.91% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 84.20% | 12.90% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 28.10% | 67.70% | 0.00% | 4.17% | NA |
| Intermediate | 90 | 85.60% | 5.60% | 0.00% | 8.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123563633 | T -> DEL | N | N | silent_mutation | Average:43.031; most accessible tissue: Minghui63 root, score: 88.578 | N | N | N | N |
| vg1123563633 | T -> C | LOC_Os11g39550.1 | downstream_gene_variant ; 1603.0bp to feature; MODIFIER | silent_mutation | Average:43.031; most accessible tissue: Minghui63 root, score: 88.578 | N | N | N | N |
| vg1123563633 | T -> C | LOC_Os11g39540-LOC_Os11g39550 | intergenic_region ; MODIFIER | silent_mutation | Average:43.031; most accessible tissue: Minghui63 root, score: 88.578 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123563633 | 1.85E-07 | NA | Plant_height | All | YES | Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652 |
| vg1123563633 | NA | 1.41E-06 | mr1278 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123563633 | NA | 2.85E-09 | mr1570 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |