\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123455671:

Variant ID: vg1123455671 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23455671
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:


TTTGAATCCACTCCCCATATATGGTTTATAACTCTAGATATTGATTCCATAATAAGGCCCAATTCCAACATACTACCTTGCAAAGATAATTCTCAGCAGC[T/C]
GGTAAATATTTCCATGAATGATATTATATATGTATTATATGTATTGAGGAACGAGACAAGAAATATAATGCGACAATTGTACCATTATACATACGAATAA

Reverse complement sequence

TTATTCGTATGTATAATGGTACAATTGTCGCATTATATTTCTTGTCTCGTTCCTCAATACATATAATACATATATAATATCATTCATGGAAATATTTACC[A/G]
GCTGCTGAGAATTATCTTTGCAAGGTAGTATGTTGGAATTGGGCCTTATTATGGAATCAATATCTAGAGTTATAAACCATATATGGGGAGTGGATTCAAA

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 21.70% 15.80% 0.53% 61.91% NA
All Indica  2759 26.60% 2.30% 0.69% 70.42% NA
All Japonica  1512 10.60% 41.10% 0.13% 48.15% NA
Aus  269 12.30% 16.40% 0.74% 70.63% NA
Indica I  595 31.10% 3.90% 0.84% 64.20% NA
Indica II  465 7.50% 3.00% 0.43% 89.03% NA
Indica III  913 34.40% 0.40% 0.11% 65.06% NA
Indica Intermediate  786 25.40% 2.80% 1.40% 70.36% NA
Temperate Japonica  767 6.50% 70.80% 0.13% 22.56% NA
Tropical Japonica  504 14.50% 5.80% 0.00% 79.76% NA
Japonica Intermediate  241 15.80% 20.30% 0.41% 63.49% NA
VI/Aromatic  96 76.00% 5.20% 1.04% 17.71% NA
Intermediate  90 27.80% 17.80% 1.11% 53.33% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123455671 T -> DEL N N silent_mutation Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1123455671 T -> C LOC_Os11g39400.1 downstream_gene_variant ; 305.0bp to feature; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1123455671 T -> C LOC_Os11g39410.1 downstream_gene_variant ; 499.0bp to feature; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1123455671 T -> C LOC_Os11g39420.1 downstream_gene_variant ; 3987.0bp to feature; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N
vg1123455671 T -> C LOC_Os11g39400-LOC_Os11g39410 intergenic_region ; MODIFIER silent_mutation Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123455671 NA 3.86E-11 Spikelet_length Jap_All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123455671 NA 1.03E-14 mr1031 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.73E-07 mr1031 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 1.13E-14 mr1056 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 3.74E-07 mr1056 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 5.23E-09 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 9.54E-06 mr1202 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.10E-07 mr1252 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 1.36E-08 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 1.50E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 7.35E-07 mr1443 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 4.67E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 3.93E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.39E-08 mr1549 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 4.07E-06 mr1576 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.74E-13 mr1611 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 3.65E-08 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 6.81E-07 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.03E-07 mr1629 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 5.21E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.02E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.74E-07 mr1733 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 3.50E-08 mr1741 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.77E-08 mr1757 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.10E-08 mr1251_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 1.63E-08 mr1364_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 2.15E-08 mr1435_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 9.75E-08 mr1599_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 5.15E-06 mr1672_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671 NA 9.91E-06 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251