Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123455671:

Variant ID: vg1123455671 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23455671
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.69, T: 0.31, others allele: 0.00, population size: 74. )

Flanking Sequence (100 bp) in Reference Genome:

TTTGAATCCACTCCCCATATATGGTTTATAACTCTAGATATTGATTCCATAATAAGGCCCAATTCCAACATACTACCTTGCAAAGATAATTCTCAGCAGC[T/C]
GGTAAATATTTCCATGAATGATATTATATATGTATTATATGTATTGAGGAACGAGACAAGAAATATAATGCGACAATTGTACCATTATACATACGAATAA

Reverse complement sequence

TTATTCGTATGTATAATGGTACAATTGTCGCATTATATTTCTTGTCTCGTTCCTCAATACATATAATACATATATAATATCATTCATGGAAATATTTACC[A/G]
GCTGCTGAGAATTATCTTTGCAAGGTAGTATGTTGGAATTGGGCCTTATTATGGAATCAATATCTAGAGTTATAAACCATATATGGGGAGTGGATTCAAA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	21.70%	15.80%	0.53%	61.91%	NA
All Indica	2759	26.60%	2.30%	0.69%	70.42%	NA
All Japonica	1512	10.60%	41.10%	0.13%	48.15%	NA
Aus	269	12.30%	16.40%	0.74%	70.63%	NA
Indica I	595	31.10%	3.90%	0.84%	64.20%	NA
Indica II	465	7.50%	3.00%	0.43%	89.03%	NA
Indica III	913	34.40%	0.40%	0.11%	65.06%	NA
Indica Intermediate	786	25.40%	2.80%	1.40%	70.36%	NA
Temperate Japonica	767	6.50%	70.80%	0.13%	22.56%	NA
Tropical Japonica	504	14.50%	5.80%	0.00%	79.76%	NA
Japonica Intermediate	241	15.80%	20.30%	0.41%	63.49%	NA
VI/Aromatic	96	76.00%	5.20%	1.04%	17.71%	NA
Intermediate	90	27.80%	17.80%	1.11%	53.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123455671	T -> DEL	N	N	silent_mutation	Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg1123455671	T -> C	LOC_Os11g39400.1	downstream_gene_variant ; 305.0bp to feature; MODIFIER	silent_mutation	Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg1123455671	T -> C	LOC_Os11g39410.1	downstream_gene_variant ; 499.0bp to feature; MODIFIER	silent_mutation	Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg1123455671	T -> C	LOC_Os11g39420.1	downstream_gene_variant ; 3987.0bp to feature; MODIFIER	silent_mutation	Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N
vg1123455671	T -> C	LOC_Os11g39400-LOC_Os11g39410	intergenic_region ; MODIFIER	silent_mutation	Average:35.199; most accessible tissue: Minghui63 flag leaf, score: 58.568	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123455671	NA	3.86E-11	Spikelet_length	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123455671	NA	1.03E-14	mr1031	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.73E-07	mr1031	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	1.13E-14	mr1056	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	3.74E-07	mr1056	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	5.23E-09	mr1137	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	9.54E-06	mr1202	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.10E-07	mr1252	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	1.36E-08	mr1271	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	1.50E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	7.35E-07	mr1443	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	4.67E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	3.93E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.39E-08	mr1549	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	4.07E-06	mr1576	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.74E-13	mr1611	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	3.65E-08	mr1617	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	6.81E-07	mr1627	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.03E-07	mr1629	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	5.21E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.02E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.74E-07	mr1733	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	3.50E-08	mr1741	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.77E-08	mr1757	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.10E-08	mr1251_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	1.63E-08	mr1364_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	2.15E-08	mr1435_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	9.75E-08	mr1599_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	5.15E-06	mr1672_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123455671	NA	9.91E-06	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251