| Variant ID: vg1123452646 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23452646 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TACCGCAACGATATTAATTAAAAGTAATAAAAGCATCACAAATAATCAATAATCGTAAATGCGATAGATAAATTTCATAATCATATATATCAGCAATAAA[A/G]
GTACCTGAAATACAAAGTTGGGTTCGAAATTCAATGTCCCGTGGCTCTTTTATGCGAGAATATGATTTTGGTGATATTTGCAAATTTCGAATGCCACTCA
TGAGTGGCATTCGAAATTTGCAAATATCACCAAAATCATATTCTCGCATAAAAGAGCCACGGGACATTGAATTTCGAACCCAACTTTGTATTTCAGGTAC[T/C]
TTTATTGCTGATATATATGATTATGAAATTTATCTATCGCATTTACGATTATTGATTATTTGTGATGCTTTTATTACTTTTAATTAATATCGTTGCGGTA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 63.40% | 0.40% | 4.63% | 31.65% | NA |
| All Indica | 2759 | 64.40% | 0.60% | 4.97% | 30.01% | NA |
| All Japonica | 1512 | 55.00% | 0.00% | 4.23% | 40.81% | NA |
| Aus | 269 | 92.60% | 0.40% | 3.35% | 3.72% | NA |
| Indica I | 595 | 58.70% | 1.20% | 6.72% | 33.45% | NA |
| Indica II | 465 | 47.10% | 0.20% | 5.38% | 47.31% | NA |
| Indica III | 913 | 76.00% | 0.50% | 4.38% | 19.06% | NA |
| Indica Intermediate | 786 | 65.60% | 0.40% | 4.07% | 29.90% | NA |
| Temperate Japonica | 767 | 78.50% | 0.00% | 0.39% | 21.12% | NA |
| Tropical Japonica | 504 | 25.60% | 0.00% | 10.91% | 63.49% | NA |
| Japonica Intermediate | 241 | 41.50% | 0.00% | 2.49% | 56.02% | NA |
| VI/Aromatic | 96 | 83.30% | 0.00% | 3.12% | 13.54% | NA |
| Intermediate | 90 | 62.20% | 0.00% | 6.67% | 31.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123452646 | A -> DEL | N | N | silent_mutation | Average:36.095; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg1123452646 | A -> G | LOC_Os11g39400.1 | upstream_gene_variant ; 1308.0bp to feature; MODIFIER | silent_mutation | Average:36.095; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg1123452646 | A -> G | LOC_Os11g39410.1 | downstream_gene_variant ; 3524.0bp to feature; MODIFIER | silent_mutation | Average:36.095; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| vg1123452646 | A -> G | LOC_Os11g39390-LOC_Os11g39400 | intergenic_region ; MODIFIER | silent_mutation | Average:36.095; most accessible tissue: Minghui63 flower, score: 77.232 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123452646 | NA | 1.62E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123452646 | NA | 4.99E-06 | mr1596_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123452646 | 8.33E-06 | 8.33E-06 | mr1889_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123452646 | NA | 4.98E-08 | mr1896_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |