| Variant ID: vg1123452531 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23452531 |
| Reference Allele: A | Alternative Allele: C |
| Primary Allele: A | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
TTATTCAAAAATATGCGCAAATTAAATGCTGGTAAAATGCACAAGTGTTGCAATATAATGGTACACAAAATTCCCGCAAACAATTCCAGTATATACTATG[A/C]
AATTCTATTCATTTTACCGCAACGATATTAATTAAAAGTAATAAAAGCATCACAAATAATCAATAATCGTAAATGCGATAGATAAATTTCATAATCATAT
ATATGATTATGAAATTTATCTATCGCATTTACGATTATTGATTATTTGTGATGCTTTTATTACTTTTAATTAATATCGTTGCGGTAAAATGAATAGAATT[T/G]
CATAGTATATACTGGAATTGTTTGCGGGAATTTTGTGTACCATTATATTGCAACACTTGTGCATTTTACCAGCATTTAATTTGCGCATATTTTTGAATAA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 34.80% | 15.00% | 3.75% | 46.45% | NA |
| All Indica | 2759 | 24.40% | 17.50% | 5.65% | 52.41% | NA |
| All Japonica | 1512 | 51.90% | 3.40% | 0.86% | 43.85% | NA |
| Aus | 269 | 27.50% | 59.90% | 1.12% | 11.52% | NA |
| Indica I | 595 | 36.50% | 6.10% | 8.57% | 48.91% | NA |
| Indica II | 465 | 9.90% | 16.60% | 1.29% | 72.26% | NA |
| Indica III | 913 | 20.40% | 26.60% | 7.67% | 45.35% | NA |
| Indica Intermediate | 786 | 28.50% | 16.30% | 3.69% | 51.53% | NA |
| Temperate Japonica | 767 | 77.40% | 0.00% | 0.39% | 22.16% | NA |
| Tropical Japonica | 504 | 20.60% | 9.70% | 1.59% | 68.06% | NA |
| Japonica Intermediate | 241 | 35.70% | 1.20% | 0.83% | 62.24% | NA |
| VI/Aromatic | 96 | 75.00% | 3.10% | 0.00% | 21.88% | NA |
| Intermediate | 90 | 44.40% | 12.20% | 5.56% | 37.78% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123452531 | A -> DEL | N | N | silent_mutation | Average:26.874; most accessible tissue: Callus, score: 51.884 | N | N | N | N |
| vg1123452531 | A -> C | LOC_Os11g39400.1 | upstream_gene_variant ; 1423.0bp to feature; MODIFIER | silent_mutation | Average:26.874; most accessible tissue: Callus, score: 51.884 | N | N | N | N |
| vg1123452531 | A -> C | LOC_Os11g39410.1 | downstream_gene_variant ; 3639.0bp to feature; MODIFIER | silent_mutation | Average:26.874; most accessible tissue: Callus, score: 51.884 | N | N | N | N |
| vg1123452531 | A -> C | LOC_Os11g39390-LOC_Os11g39400 | intergenic_region ; MODIFIER | silent_mutation | Average:26.874; most accessible tissue: Callus, score: 51.884 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123452531 | NA | 7.69E-06 | mr1703_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |