| Variant ID: vg1123450985 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23450985 |
| Reference Allele: A | Alternative Allele: T |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GAGACACTGGATGTTTGCTGCTTCGGAAGCGCATTTATCCATACAGTACCAAATGGAAGCCGCATATATTCTTCGCAATCCAGTTCAGGGATGCTAGAAC[A/T]
ATATGCGGTTTATGCATTGATCTCCTATCGGTGCATACTGGCACACAAATCTTCATGATTTAGGAAAATTATACATATATGTGCTATGACCATACGAGTT
AACTCGTATGGTCATAGCACATATATGTATAATTTTCCTAAATCATGAAGATTTGTGTGCCAGTATGCACCGATAGGAGATCAATGCATAAACCGCATAT[T/A]
GTTCTAGCATCCCTGAACTGGATTGCGAAGAATATATGCGGCTTCCATTTGGTACTGTATGGATAAATGCGCTTCCGAAGCAGCAAACATCCAGTGTCTC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 51.30% | 3.10% | 21.10% | 24.57% | NA |
| All Indica | 2759 | 50.70% | 4.50% | 27.44% | 17.29% | NA |
| All Japonica | 1512 | 53.80% | 0.50% | 5.49% | 40.28% | NA |
| Aus | 269 | 32.30% | 3.30% | 44.98% | 19.33% | NA |
| Indica I | 595 | 44.20% | 9.40% | 22.35% | 24.03% | NA |
| Indica II | 465 | 41.50% | 2.80% | 28.17% | 27.53% | NA |
| Indica III | 913 | 59.40% | 3.60% | 30.34% | 6.68% | NA |
| Indica Intermediate | 786 | 51.10% | 2.90% | 27.48% | 18.45% | NA |
| Temperate Japonica | 767 | 78.60% | 0.40% | 4.69% | 16.30% | NA |
| Tropical Japonica | 504 | 22.60% | 0.20% | 7.14% | 70.04% | NA |
| Japonica Intermediate | 241 | 39.80% | 1.20% | 4.56% | 54.36% | NA |
| VI/Aromatic | 96 | 77.10% | 3.10% | 16.67% | 3.12% | NA |
| Intermediate | 90 | 54.40% | 1.10% | 22.22% | 22.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123450985 | A -> T | LOC_Os11g39400.1 | upstream_gene_variant ; 2969.0bp to feature; MODIFIER | silent_mutation | Average:24.238; most accessible tissue: Minghui63 flower, score: 53.366 | N | N | N | N |
| vg1123450985 | A -> T | LOC_Os11g39390-LOC_Os11g39400 | intergenic_region ; MODIFIER | silent_mutation | Average:24.238; most accessible tissue: Minghui63 flower, score: 53.366 | N | N | N | N |
| vg1123450985 | A -> DEL | N | N | silent_mutation | Average:24.238; most accessible tissue: Minghui63 flower, score: 53.366 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123450985 | 6.38E-07 | 1.72E-07 | mr1134 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | 3.89E-06 | 7.49E-07 | mr1504 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 8.44E-06 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 5.09E-06 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 6.16E-07 | mr1100_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 8.72E-06 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 1.37E-06 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 1.65E-08 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123450985 | NA | 5.79E-06 | mr1962_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |