Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123449893:

Variant ID: vg1123449893 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23449893
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:

CAACTCCAGGTTGACTGCCAATGACTTTTGTTGTCTAAAAGAGACATTTGCCCATAAACAGTCTCATTGCTAACTTCTATTGGTTGCATGAGACTCTATG[T/C]
GAATATCCATGGATATACGAGGAGATGCATTTTCATATGCTTCATCTTCTTCTTTGCTTAATACTTCTTGATGTGGGCATGTACCAGCGTTAGTGTGCAC

Reverse complement sequence

GTGCACACTAACGCTGGTACATGCCCACATCAAGAAGTATTAAGCAAAGAAGAAGATGAAGCATATGAAAATGCATCTCCTCGTATATCCATGGATATTC[A/G]
CATAGAGTCTCATGCAACCAATAGAAGTTAGCAATGAGACTGTTTATGGGCAAATGTCTCTTTTAGACAACAAAAGTCATTGGCAGTCAACCTGGAGTTG

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.70%	11.30%	0.04%	0.00%	NA
All Indica	2759	98.40%	1.60%	0.07%	0.00%	NA
All Japonica	1512	68.30%	31.70%	0.00%	0.00%	NA
Aus	269	98.90%	1.10%	0.00%	0.00%	NA
Indica I	595	96.30%	3.70%	0.00%	0.00%	NA
Indica II	465	98.90%	1.10%	0.00%	0.00%	NA
Indica III	913	99.70%	0.30%	0.00%	0.00%	NA
Indica Intermediate	786	98.10%	1.70%	0.25%	0.00%	NA
Temperate Japonica	767	44.50%	55.50%	0.00%	0.00%	NA
Tropical Japonica	504	94.00%	6.00%	0.00%	0.00%	NA
Japonica Intermediate	241	90.00%	10.00%	0.00%	0.00%	NA
VI/Aromatic	96	100.00%	0.00%	0.00%	0.00%	NA
Intermediate	90	92.20%	7.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123449893	T -> C	LOC_Os11g39400.1	upstream_gene_variant ; 4061.0bp to feature; MODIFIER	silent_mutation	Average:21.738; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N
vg1123449893	T -> C	LOC_Os11g39390-LOC_Os11g39400	intergenic_region ; MODIFIER	silent_mutation	Average:21.738; most accessible tissue: Minghui63 flag leaf, score: 44.406	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123449893	NA	7.04E-14	Spikelet_length	All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123449893	NA	2.91E-06	mr1192	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	1.33E-06	mr1330	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	3.33E-10	mr1486	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	9.98E-06	mr1531	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	6.99E-06	mr1548	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	5.62E-06	mr1576	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	8.43E-06	mr1672	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	3.36E-06	mr1729	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	1.85E-06	mr1741	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	1.92E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	4.68E-06	1.57E-10	mr1693_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	8.43E-08	mr1693_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893	NA	3.04E-06	mr1703_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251