Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123449893:

Variant ID: vg1123449893 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23449893
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 227. )

Flanking Sequence (100 bp) in Reference Genome:


CAACTCCAGGTTGACTGCCAATGACTTTTGTTGTCTAAAAGAGACATTTGCCCATAAACAGTCTCATTGCTAACTTCTATTGGTTGCATGAGACTCTATG[T/C]
GAATATCCATGGATATACGAGGAGATGCATTTTCATATGCTTCATCTTCTTCTTTGCTTAATACTTCTTGATGTGGGCATGTACCAGCGTTAGTGTGCAC

Reverse complement sequence

GTGCACACTAACGCTGGTACATGCCCACATCAAGAAGTATTAAGCAAAGAAGAAGATGAAGCATATGAAAATGCATCTCCTCGTATATCCATGGATATTC[A/G]
CATAGAGTCTCATGCAACCAATAGAAGTTAGCAATGAGACTGTTTATGGGCAAATGTCTCTTTTAGACAACAAAAGTCATTGGCAGTCAACCTGGAGTTG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 88.70% 11.30% 0.04% 0.00% NA
All Indica  2759 98.40% 1.60% 0.07% 0.00% NA
All Japonica  1512 68.30% 31.70% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 96.30% 3.70% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 99.70% 0.30% 0.00% 0.00% NA
Indica Intermediate  786 98.10% 1.70% 0.25% 0.00% NA
Temperate Japonica  767 44.50% 55.50% 0.00% 0.00% NA
Tropical Japonica  504 94.00% 6.00% 0.00% 0.00% NA
Japonica Intermediate  241 90.00% 10.00% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123449893 T -> C LOC_Os11g39400.1 upstream_gene_variant ; 4061.0bp to feature; MODIFIER silent_mutation Average:21.738; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N
vg1123449893 T -> C LOC_Os11g39390-LOC_Os11g39400 intergenic_region ; MODIFIER silent_mutation Average:21.738; most accessible tissue: Minghui63 flag leaf, score: 44.406 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123449893 NA 7.04E-14 Spikelet_length All Not Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123449893 NA 2.91E-06 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 1.33E-06 mr1330 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 3.33E-10 mr1486 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 9.98E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 6.99E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 5.62E-06 mr1576 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 8.43E-06 mr1672 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 3.36E-06 mr1729 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 1.85E-06 mr1741 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 1.92E-06 mr1585_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 4.68E-06 1.57E-10 mr1693_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 8.43E-08 mr1693_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123449893 NA 3.04E-06 mr1703_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251