\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123438684:

Variant ID: vg1123438684 (JBrowse)Variation Type: INDEL
Chromosome: chr11Position: 23438684
Reference Allele: GAlternative Allele: A,GTC
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCTACACAGCCCAAACAACTATCTCATCTTGTATGTTGGTAATTAGGAGAGCACGAATTAGAAGGTGGGAACAATCATCATCCTATTAAACTAATCTTTT[G/A,GTC]
GGTTGTAGACTTACCTAACATTGTAACTCCGGTTGAACCTGTGATGGAGCAGGCCGATGTAATCTGGGTGGCTCATAATTGGTAGGTCGGGCTACACACT

Reverse complement sequence

AGTGTGTAGCCCGACCTACCAATTATGAGCCACCCAGATTACATCGGCCTGCTCCATCACAGGTTCAACCGGAGTTACAATGTTAGGTAAGTCTACAACC[C/T,GAC]
AAAAGATTAGTTTAATAGGATGATGATTGTTCCCACCTTCTAATTCGTGCTCTCCTAATTACCAACATACAAGATGAGATAGTTGTTTGGGCTGTGTAGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 90.90% 0.80% 1.90% 6.31% GTC: 0.02%
All Indica  2759 87.10% 1.30% 1.30% 10.33% NA
All Japonica  1512 96.00% 0.30% 3.57% 0.07% GTC: 0.07%
Aus  269 99.30% 0.00% 0.00% 0.74% NA
Indica I  595 73.90% 1.00% 2.86% 22.18% NA
Indica II  465 97.60% 0.40% 0.00% 1.94% NA
Indica III  913 92.20% 1.60% 0.88% 5.26% NA
Indica Intermediate  786 84.90% 1.50% 1.40% 12.21% NA
Temperate Japonica  767 92.40% 0.50% 6.78% 0.13% GTC: 0.13%
Tropical Japonica  504 100.00% 0.00% 0.00% 0.00% NA
Japonica Intermediate  241 99.20% 0.00% 0.83% 0.00% NA
VI/Aromatic  96 96.90% 0.00% 0.00% 3.12% NA
Intermediate  90 91.10% 1.10% 0.00% 7.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123438684 G -> A LOC_Os11g39370.1 upstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> A LOC_Os11g39380.1 upstream_gene_variant ; 4799.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> A LOC_Os11g39370.2 upstream_gene_variant ; 1877.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> A LOC_Os11g39370-LOC_Os11g39380 intergenic_region ; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> DEL N N silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> GTC LOC_Os11g39370.1 upstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> GTC LOC_Os11g39380.1 upstream_gene_variant ; 4798.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> GTC LOC_Os11g39370.2 upstream_gene_variant ; 1878.0bp to feature; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N
vg1123438684 G -> GTC LOC_Os11g39370-LOC_Os11g39380 intergenic_region ; MODIFIER silent_mutation Average:81.89; most accessible tissue: Minghui63 young leaf, score: 91.049 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123438684 G A -0.04 -0.01 -0.01 0.0 -0.02 -0.01
vg1123438684 G GTC -0.27 -0.18 -0.24 -0.01 -0.09 -0.04

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123438684 NA 8.26E-06 mr1201 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123438684 NA 4.34E-06 mr1201_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251