Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123404382:

Variant ID: vg1123404382 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23404382
Reference Allele: C	Alternative Allele: T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGGGACAGGGCAATCAAGGGAGAATCTCTCAAGCTCTTTGAACCCTTCTTTCTCAATCACTATTGGATTTTCAGGAATGAACTCCAAGCCTAGTACCAGG[C/T]
GCTGTAATTTGATCAAGCCCGCGAGGATCTTGACATCATCTGCCACTTGTTTGCAGACCGTGATCTGCAAGAAAGTAAGACGGTCGAGCCTTTCGATCCA

Reverse complement sequence

TGGATCGAAAGGCTCGACCGTCTTACTTTCTTGCAGATCACGGTCTGCAAACAAGTGGCAGATGATGTCAAGATCCTCGCGGGCTTGATCAAATTACAGC[G/A]
CCTGGTACTAGGCTTGGAGTTCATTCCTGAAAATCCAATAGTGATTGAGAAAGAAGGGTTCAAAGAGCTTGAGAGATTCTCCCTTGATTGCCCTGTCCCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	60.60%	39.40%	0.04%	0.00%	NA
All Indica	2759	63.40%	36.50%	0.04%	0.00%	NA
All Japonica	1512	63.40%	36.60%	0.00%	0.00%	NA
Aus	269	7.40%	92.60%	0.00%	0.00%	NA
Indica I	595	32.90%	67.10%	0.00%	0.00%	NA
Indica II	465	94.80%	4.90%	0.22%	0.00%	NA
Indica III	913	72.40%	27.60%	0.00%	0.00%	NA
Indica Intermediate	786	57.50%	42.50%	0.00%	0.00%	NA
Temperate Japonica	767	78.50%	21.50%	0.00%	0.00%	NA
Tropical Japonica	504	38.10%	61.90%	0.00%	0.00%	NA
Japonica Intermediate	241	68.50%	31.50%	0.00%	0.00%	NA
VI/Aromatic	96	77.10%	22.90%	0.00%	0.00%	NA
Intermediate	90	65.60%	33.30%	1.11%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123404382	C -> T	LOC_Os11g39310.1	missense_variant ; p.Arg817His; MODERATE	nonsynonymous_codon ; R817H	Average:58.686; most accessible tissue: Zhenshan97 flower, score: 82.718	benign	0.433	TOLERATED	0.55

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123404382	NA	8.62E-09	mr1557	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	1.20E-07	mr1829	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	1.84E-09	mr1942	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	8.23E-06	mr1201_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	6.78E-06	mr1232_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	4.45E-13	mr1557_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	3.84E-14	mr1598_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	1.73E-06	mr1619_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	8.28E-06	mr1795_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	2.09E-09	mr1829_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404382	NA	3.18E-10	mr1962_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251