\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123404294:

Variant ID: vg1123404294 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23404294
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAACACTCATCTCGCTTGCAGGGGATGCGTGCAAATTCAGTCGAAGATATGTGAGTTTCGGCATAGCCTCTTCTTCGAAGGTCAGCCATGGGACAGGGCA[A/G]
TCAAGGGAGAATCTCTCAAGCTCTTTGAACCCTTCTTTCTCAATCACTATTGGATTTTCAGGAATGAACTCCAAGCCTAGTACCAGGCGCTGTAATTTGA

Reverse complement sequence

TCAAATTACAGCGCCTGGTACTAGGCTTGGAGTTCATTCCTGAAAATCCAATAGTGATTGAGAAAGAAGGGTTCAAAGAGCTTGAGAGATTCTCCCTTGA[T/C]
TGCCCTGTCCCATGGCTGACCTTCGAAGAAGAGGCTATGCCGAAACTCACATATCTTCGACTGAATTTGCACGCATCCCCTGCAAGCGAGATGAGTGTTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 76.80% 23.00% 0.17% 0.00% NA
All Indica  2759 81.90% 17.90% 0.18% 0.00% NA
All Japonica  1512 63.20% 36.70% 0.07% 0.00% NA
Aus  269 95.50% 4.50% 0.00% 0.00% NA
Indica I  595 83.20% 16.80% 0.00% 0.00% NA
Indica II  465 95.30% 4.30% 0.43% 0.00% NA
Indica III  913 67.70% 32.30% 0.00% 0.00% NA
Indica Intermediate  786 89.60% 10.10% 0.38% 0.00% NA
Temperate Japonica  767 34.70% 65.30% 0.00% 0.00% NA
Tropical Japonica  504 96.20% 3.80% 0.00% 0.00% NA
Japonica Intermediate  241 85.10% 14.50% 0.41% 0.00% NA
VI/Aromatic  96 87.50% 12.50% 0.00% 0.00% NA
Intermediate  90 80.00% 17.80% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123404294 A -> G LOC_Os11g39310.1 synonymous_variant ; p.Asp846Asp; LOW synonymous_codon Average:67.81; most accessible tissue: Callus, score: 87.962 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123404294 A G 0.02 0.02 0.01 0.01 0.0 0.0

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123404294 NA 1.29E-06 mr1063 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 3.60E-11 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 8.13E-08 mr1192 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 2.93E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 2.12E-07 mr1271 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 2.81E-08 mr1295 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 3.67E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 2.45E-06 mr1548 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 8.06E-07 mr1570 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 1.48E-10 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 2.17E-06 mr1829 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 5.85E-06 mr1161_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 9.43E-07 mr1570_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 4.65E-06 mr1617_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123404294 NA 7.81E-06 mr1768_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251