\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123394093:

Variant ID: vg1123394093 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23394093
Reference Allele: CAlternative Allele: G
Primary Allele: CSecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACATATTTAATTTTTAAGCTTTTGGACTGTTGGGGCAAAATCCAACGATTGAGTGTGTATTCTTTTTTGTATTCGATGCCTCAATCGCGGGCAACGTTTA[C/G]
ATATTTATACGAGAGTGTACAAAGGGAAATTACACTGCTACCCATATTATCAACTAATCTAAGTGGCTGGCTAGTGGGCCAGCTTGTGGGCTCTCGGGTA

Reverse complement sequence

TACCCGAGAGCCCACAAGCTGGCCCACTAGCCAGCCACTTAGATTAGTTGATAATATGGGTAGCAGTGTAATTTCCCTTTGTACACTCTCGTATAAATAT[G/C]
TAAACGTTGCCCGCGATTGAGGCATCGAATACAAAAAAGAATACACACTCAATCGTTGGATTTTGCCCCAACAGTCCAAAAGCTTAAAAATTAAATATGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.00% 2.60% 1.33% 52.98% NA
All Indica  2759 36.30% 0.00% 1.01% 62.67% NA
All Japonica  1512 58.80% 8.00% 1.12% 32.08% NA
Aus  269 26.40% 0.00% 4.46% 69.14% NA
Indica I  595 63.70% 0.00% 0.34% 35.97% NA
Indica II  465 8.40% 0.00% 1.29% 90.32% NA
Indica III  913 34.00% 0.00% 0.99% 65.06% NA
Indica Intermediate  786 34.90% 0.00% 1.40% 63.74% NA
Temperate Japonica  767 67.80% 7.70% 1.04% 23.47% NA
Tropical Japonica  504 51.00% 11.50% 0.99% 36.51% NA
Japonica Intermediate  241 46.50% 1.70% 1.66% 50.21% NA
VI/Aromatic  96 34.40% 0.00% 3.12% 62.50% NA
Intermediate  90 43.30% 4.40% 3.33% 48.89% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123394093 C -> DEL N N silent_mutation Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1123394093 C -> G LOC_Os11g39290.1 upstream_gene_variant ; 379.0bp to feature; MODIFIER silent_mutation Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1123394093 C -> G LOC_Os11g39300.1 upstream_gene_variant ; 4768.0bp to feature; MODIFIER silent_mutation Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1123394093 C -> G LOC_Os11g39280.1 downstream_gene_variant ; 2385.0bp to feature; MODIFIER silent_mutation Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N
vg1123394093 C -> G LOC_Os11g39280-LOC_Os11g39290 intergenic_region ; MODIFIER silent_mutation Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123394093 3.53E-06 3.53E-06 mr1065 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 1.23E-06 1.23E-06 mr1067 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 2.00E-06 2.00E-06 mr1068 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 4.26E-06 1.14E-06 mr1090 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 NA 7.71E-06 mr1124 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 6.17E-09 6.17E-09 mr1200 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 1.41E-06 4.08E-07 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 3.23E-06 NA mr1504 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 2.61E-06 2.61E-06 mr1750 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093 1.43E-06 1.43E-06 mr1855 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251