Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123394093:

Variant ID: vg1123394093 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23394093
Reference Allele: C	Alternative Allele: G
Primary Allele: C	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ACATATTTAATTTTTAAGCTTTTGGACTGTTGGGGCAAAATCCAACGATTGAGTGTGTATTCTTTTTTGTATTCGATGCCTCAATCGCGGGCAACGTTTA[C/G]
ATATTTATACGAGAGTGTACAAAGGGAAATTACACTGCTACCCATATTATCAACTAATCTAAGTGGCTGGCTAGTGGGCCAGCTTGTGGGCTCTCGGGTA

Reverse complement sequence

TACCCGAGAGCCCACAAGCTGGCCCACTAGCCAGCCACTTAGATTAGTTGATAATATGGGTAGCAGTGTAATTTCCCTTTGTACACTCTCGTATAAATAT[G/C]
TAAACGTTGCCCGCGATTGAGGCATCGAATACAAAAAAGAATACACACTCAATCGTTGGATTTTGCCCCAACAGTCCAAAAGCTTAAAAATTAAATATGT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	43.00%	2.60%	1.33%	52.98%	NA
All Indica	2759	36.30%	0.00%	1.01%	62.67%	NA
All Japonica	1512	58.80%	8.00%	1.12%	32.08%	NA
Aus	269	26.40%	0.00%	4.46%	69.14%	NA
Indica I	595	63.70%	0.00%	0.34%	35.97%	NA
Indica II	465	8.40%	0.00%	1.29%	90.32%	NA
Indica III	913	34.00%	0.00%	0.99%	65.06%	NA
Indica Intermediate	786	34.90%	0.00%	1.40%	63.74%	NA
Temperate Japonica	767	67.80%	7.70%	1.04%	23.47%	NA
Tropical Japonica	504	51.00%	11.50%	0.99%	36.51%	NA
Japonica Intermediate	241	46.50%	1.70%	1.66%	50.21%	NA
VI/Aromatic	96	34.40%	0.00%	3.12%	62.50%	NA
Intermediate	90	43.30%	4.40%	3.33%	48.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123394093	C -> DEL	N	N	silent_mutation	Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1123394093	C -> G	LOC_Os11g39290.1	upstream_gene_variant ; 379.0bp to feature; MODIFIER	silent_mutation	Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1123394093	C -> G	LOC_Os11g39300.1	upstream_gene_variant ; 4768.0bp to feature; MODIFIER	silent_mutation	Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1123394093	C -> G	LOC_Os11g39280.1	downstream_gene_variant ; 2385.0bp to feature; MODIFIER	silent_mutation	Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N
vg1123394093	C -> G	LOC_Os11g39280-LOC_Os11g39290	intergenic_region ; MODIFIER	silent_mutation	Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123394093	3.53E-06	3.53E-06	mr1065	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	1.23E-06	1.23E-06	mr1067	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	2.00E-06	2.00E-06	mr1068	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	4.26E-06	1.14E-06	mr1090	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	NA	7.71E-06	mr1124	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	6.17E-09	6.17E-09	mr1200	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	1.41E-06	4.08E-07	mr1211	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	3.23E-06	NA	mr1504	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	2.61E-06	2.61E-06	mr1750	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123394093	1.43E-06	1.43E-06	mr1855	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251