\
| Variant ID: vg1123394093 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23394093 |
| Reference Allele: C | Alternative Allele: G |
| Primary Allele: C | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
ACATATTTAATTTTTAAGCTTTTGGACTGTTGGGGCAAAATCCAACGATTGAGTGTGTATTCTTTTTTGTATTCGATGCCTCAATCGCGGGCAACGTTTA[C/G]
ATATTTATACGAGAGTGTACAAAGGGAAATTACACTGCTACCCATATTATCAACTAATCTAAGTGGCTGGCTAGTGGGCCAGCTTGTGGGCTCTCGGGTA
TACCCGAGAGCCCACAAGCTGGCCCACTAGCCAGCCACTTAGATTAGTTGATAATATGGGTAGCAGTGTAATTTCCCTTTGTACACTCTCGTATAAATAT[G/C]
TAAACGTTGCCCGCGATTGAGGCATCGAATACAAAAAAGAATACACACTCAATCGTTGGATTTTGCCCCAACAGTCCAAAAGCTTAAAAATTAAATATGT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 43.00% | 2.60% | 1.33% | 52.98% | NA |
| All Indica | 2759 | 36.30% | 0.00% | 1.01% | 62.67% | NA |
| All Japonica | 1512 | 58.80% | 8.00% | 1.12% | 32.08% | NA |
| Aus | 269 | 26.40% | 0.00% | 4.46% | 69.14% | NA |
| Indica I | 595 | 63.70% | 0.00% | 0.34% | 35.97% | NA |
| Indica II | 465 | 8.40% | 0.00% | 1.29% | 90.32% | NA |
| Indica III | 913 | 34.00% | 0.00% | 0.99% | 65.06% | NA |
| Indica Intermediate | 786 | 34.90% | 0.00% | 1.40% | 63.74% | NA |
| Temperate Japonica | 767 | 67.80% | 7.70% | 1.04% | 23.47% | NA |
| Tropical Japonica | 504 | 51.00% | 11.50% | 0.99% | 36.51% | NA |
| Japonica Intermediate | 241 | 46.50% | 1.70% | 1.66% | 50.21% | NA |
| VI/Aromatic | 96 | 34.40% | 0.00% | 3.12% | 62.50% | NA |
| Intermediate | 90 | 43.30% | 4.40% | 3.33% | 48.89% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123394093 | C -> DEL | N | N | silent_mutation | Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1123394093 | C -> G | LOC_Os11g39290.1 | upstream_gene_variant ; 379.0bp to feature; MODIFIER | silent_mutation | Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1123394093 | C -> G | LOC_Os11g39300.1 | upstream_gene_variant ; 4768.0bp to feature; MODIFIER | silent_mutation | Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1123394093 | C -> G | LOC_Os11g39280.1 | downstream_gene_variant ; 2385.0bp to feature; MODIFIER | silent_mutation | Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| vg1123394093 | C -> G | LOC_Os11g39280-LOC_Os11g39290 | intergenic_region ; MODIFIER | silent_mutation | Average:30.819; most accessible tissue: Zhenshan97 panicle, score: 81.752 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123394093 | 3.53E-06 | 3.53E-06 | mr1065 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 1.23E-06 | 1.23E-06 | mr1067 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 2.00E-06 | 2.00E-06 | mr1068 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 4.26E-06 | 1.14E-06 | mr1090 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | NA | 7.71E-06 | mr1124 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 6.17E-09 | 6.17E-09 | mr1200 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 1.41E-06 | 4.08E-07 | mr1211 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 3.23E-06 | NA | mr1504 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 2.61E-06 | 2.61E-06 | mr1750 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123394093 | 1.43E-06 | 1.43E-06 | mr1855 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |