Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923).

Detailed information for vg1123390040:

Variant ID: vg1123390040 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23390040
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGATGCCAGAATGGCGGCAGCCGCGAAGGAGGAGATGGAGGGAGTACTAAGGGCGATGGATCGTCTTCCCGGTAGGATATCCGATCTGCTCCGGTCGGAG[C/A]
GTGGGCACGCCGGCCTCTCCGTCCTCGCCCGCCGTGGCTTCGTCTTCACGGAGACGGAGCTGAGCAGCCTTGTTGCAGCACTGCGGCAGCTGCTGGCATC

Reverse complement sequence

GATGCCAGCAGCTGCCGCAGTGCTGCAACAAGGCTGCTCAGCTCCGTCTCCGTGAAGACGAAGCCACGGCGGGCGAGGACGGAGAGGCCGGCGTGCCCAC[G/T]
CTCCGACCGGAGCAGATCGGATATCCTACCGGGAAGACGATCCATCGCCCTTAGTACTCCCTCCATCTCCTCCTTCGCGGCTGCCGCCATTCTGGCATCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	45.50%	1.40%	1.21%	51.99%	NA
All Indica	2759	36.80%	0.30%	1.01%	61.91%	NA
All Japonica	1512	64.40%	3.70%	0.79%	31.15%	NA
Aus	269	27.90%	0.00%	4.09%	68.03%	NA
Indica I	595	62.40%	0.70%	0.00%	36.97%	NA
Indica II	465	10.80%	0.00%	2.80%	86.45%	NA
Indica III	913	34.40%	0.00%	0.55%	65.06%	NA
Indica Intermediate	786	35.60%	0.50%	1.27%	62.60%	NA
Temperate Japonica	767	70.00%	7.00%	1.04%	21.90%	NA
Tropical Japonica	504	62.90%	0.00%	0.40%	36.71%	NA
Japonica Intermediate	241	49.40%	0.80%	0.83%	48.96%	NA
VI/Aromatic	96	38.50%	0.00%	6.25%	55.21%	NA
Intermediate	90	53.30%	0.00%	0.00%	46.67%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123390040	C -> A	LOC_Os11g39280.1	missense_variant ; p.Arg58Ser; MODERATE	nonsynonymous_codon ; R58S	Average:47.571; most accessible tissue: Zhenshan97 panicle, score: 96.335	unknown	unknown	DELETERIOUS	0.00
vg1123390040	C -> DEL	LOC_Os11g39280.1	N	frameshift_variant	Average:47.571; most accessible tissue: Zhenshan97 panicle, score: 96.335	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1123390040	C	A	-0.02	-0.03	-0.03	0.02	-0.01	-0.01

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123390040	5.13E-06	5.13E-06	mr1346	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123390040	2.98E-06	2.98E-06	mr1456	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123390040	NA	4.19E-06	mr1686	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123390040	7.54E-06	7.53E-06	mr1803	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123390040	NA	2.54E-06	mr1585_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251