\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123329733:

Variant ID: vg1123329733 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23329733
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


TCAACCAAGGCAGGTCAAGGGTCCAAGAGCCTTATCCTCTGAGAACGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCAACAAACTG[A/G]
CTGATCGAAGTCGGTAAAAGAGAAGACGCTCGTACACAAAACATTGGTCTCTAAATTTAATTCATTTTCAGTTTTCCATACATATTATAACATGTCACCC

Reverse complement sequence

GGGTGACATGTTATAATATGTATGGAAAACTGAAAATGAATTAAATTTAGAGACCAATGTTTTGTGTACGAGCGTCTTCTCTTTTACCGACTTCGATCAG[T/C]
CAGTTTGTTGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCAGAGGATAAGGCTCTTGGACCCTTGACCTGCCTTGGTTGA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 78.50% 1.20% 2.79% 17.56% NA
All Indica  2759 78.90% 0.00% 3.23% 17.80% NA
All Japonica  1512 77.10% 3.60% 2.18% 17.06% NA
Aus  269 82.20% 0.00% 1.86% 15.99% NA
Indica I  595 80.20% 0.00% 2.86% 16.97% NA
Indica II  465 65.60% 0.00% 6.24% 28.17% NA
Indica III  913 85.80% 0.00% 1.97% 12.27% NA
Indica Intermediate  786 78.00% 0.10% 3.18% 18.70% NA
Temperate Japonica  767 69.60% 7.00% 3.52% 19.82% NA
Tropical Japonica  504 88.10% 0.00% 0.40% 11.51% NA
Japonica Intermediate  241 78.00% 0.40% 1.66% 19.92% NA
VI/Aromatic  96 75.00% 0.00% 1.04% 23.96% NA
Intermediate  90 78.90% 0.00% 4.44% 16.67% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123329733 A -> DEL N N silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg1123329733 A -> G LOC_Os11g39190.1 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg1123329733 A -> G LOC_Os11g39190.2 upstream_gene_variant ; 3930.0bp to feature; MODIFIER silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg1123329733 A -> G LOC_Os11g39190.4 upstream_gene_variant ; 3930.0bp to feature; MODIFIER silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg1123329733 A -> G LOC_Os11g39190.3 upstream_gene_variant ; 3939.0bp to feature; MODIFIER silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N
vg1123329733 A -> G LOC_Os11g39170-LOC_Os11g39190 intergenic_region ; MODIFIER silent_mutation Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123329733 NA 3.62E-06 mr1045 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 3.09E-06 NA mr1238 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 6.89E-06 NA mr1309 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 4.62E-06 NA mr1238_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 4.00E-06 NA mr1310_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 2.30E-07 NA mr1841_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123329733 7.28E-06 NA mr1900_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251