\
| Variant ID: vg1123329733 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23329733 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele: Not determined.
TCAACCAAGGCAGGTCAAGGGTCCAAGAGCCTTATCCTCTGAGAACGATTCTCCGACGACAAGGCTGGGGGCTAGGGAGAGTGTATGACTCAACAAACTG[A/G]
CTGATCGAAGTCGGTAAAAGAGAAGACGCTCGTACACAAAACATTGGTCTCTAAATTTAATTCATTTTCAGTTTTCCATACATATTATAACATGTCACCC
GGGTGACATGTTATAATATGTATGGAAAACTGAAAATGAATTAAATTTAGAGACCAATGTTTTGTGTACGAGCGTCTTCTCTTTTACCGACTTCGATCAG[T/C]
CAGTTTGTTGAGTCATACACTCTCCCTAGCCCCCAGCCTTGTCGTCGGAGAATCGTTCTCAGAGGATAAGGCTCTTGGACCCTTGACCTGCCTTGGTTGA
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 78.50% | 1.20% | 2.79% | 17.56% | NA |
| All Indica | 2759 | 78.90% | 0.00% | 3.23% | 17.80% | NA |
| All Japonica | 1512 | 77.10% | 3.60% | 2.18% | 17.06% | NA |
| Aus | 269 | 82.20% | 0.00% | 1.86% | 15.99% | NA |
| Indica I | 595 | 80.20% | 0.00% | 2.86% | 16.97% | NA |
| Indica II | 465 | 65.60% | 0.00% | 6.24% | 28.17% | NA |
| Indica III | 913 | 85.80% | 0.00% | 1.97% | 12.27% | NA |
| Indica Intermediate | 786 | 78.00% | 0.10% | 3.18% | 18.70% | NA |
| Temperate Japonica | 767 | 69.60% | 7.00% | 3.52% | 19.82% | NA |
| Tropical Japonica | 504 | 88.10% | 0.00% | 0.40% | 11.51% | NA |
| Japonica Intermediate | 241 | 78.00% | 0.40% | 1.66% | 19.92% | NA |
| VI/Aromatic | 96 | 75.00% | 0.00% | 1.04% | 23.96% | NA |
| Intermediate | 90 | 78.90% | 0.00% | 4.44% | 16.67% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123329733 | A -> DEL | N | N | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg1123329733 | A -> G | LOC_Os11g39190.1 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg1123329733 | A -> G | LOC_Os11g39190.2 | upstream_gene_variant ; 3930.0bp to feature; MODIFIER | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg1123329733 | A -> G | LOC_Os11g39190.4 | upstream_gene_variant ; 3930.0bp to feature; MODIFIER | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg1123329733 | A -> G | LOC_Os11g39190.3 | upstream_gene_variant ; 3939.0bp to feature; MODIFIER | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| vg1123329733 | A -> G | LOC_Os11g39170-LOC_Os11g39190 | intergenic_region ; MODIFIER | silent_mutation | Average:30.695; most accessible tissue: Zhenshan97 flower, score: 60.301 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123329733 | NA | 3.62E-06 | mr1045 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 3.09E-06 | NA | mr1238 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 6.89E-06 | NA | mr1309 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 4.62E-06 | NA | mr1238_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 4.00E-06 | NA | mr1310_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 2.30E-07 | NA | mr1841_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123329733 | 7.28E-06 | NA | mr1900_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |