\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123298102:

Variant ID: vg1123298102 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23298102
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 291. )

Flanking Sequence (100 bp) in Reference Genome:


TCCAGAATGCTCCTTTCTTTGTCACGAAACTAGGAATCAAAACATTGCCCTGCGTGATATTGTTCAAGTAAGTGCATAAACTTTCATCATTTTACCCATC[G/A]
GATTTGGATAACGTGTGCTTAAATGTTTGGTGCTCCTTGCTATAACCTTTTCATCATGCGAGGACCAATCCAATAGTCAGGGTTCTGTTTTTGCTCTCGA

Reverse complement sequence

TCGAGAGCAAAAACAGAACCCTGACTATTGGATTGGTCCTCGCATGATGAAAAGGTTATAGCAAGGAGCACCAAACATTTAAGCACACGTTATCCAAATC[C/T]
GATGGGTAAAATGATGAAAGTTTATGCACTTACTTGAACAATATCACGCAGGGCAATGTTTTGATTCCTAGTTTCGTGACAAAGAAAGGAGCATTCTGGA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 82.00% 18.00% 0.02% 0.00% NA
All Indica  2759 88.20% 11.80% 0.04% 0.00% NA
All Japonica  1512 69.90% 30.10% 0.00% 0.00% NA
Aus  269 82.90% 17.10% 0.00% 0.00% NA
Indica I  595 60.20% 39.80% 0.00% 0.00% NA
Indica II  465 98.90% 1.10% 0.00% 0.00% NA
Indica III  913 98.10% 1.90% 0.00% 0.00% NA
Indica Intermediate  786 91.50% 8.40% 0.13% 0.00% NA
Temperate Japonica  767 82.90% 17.10% 0.00% 0.00% NA
Tropical Japonica  504 50.00% 50.00% 0.00% 0.00% NA
Japonica Intermediate  241 70.10% 29.90% 0.00% 0.00% NA
VI/Aromatic  96 93.80% 6.20% 0.00% 0.00% NA
Intermediate  90 78.90% 21.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123298102 G -> A LOC_Os11g39130.1 downstream_gene_variant ; 3539.0bp to feature; MODIFIER silent_mutation Average:45.017; most accessible tissue: Minghui63 flower, score: 56.131 N N N N
vg1123298102 G -> A LOC_Os11g39150.1 downstream_gene_variant ; 1995.0bp to feature; MODIFIER silent_mutation Average:45.017; most accessible tissue: Minghui63 flower, score: 56.131 N N N N
vg1123298102 G -> A LOC_Os11g39130.4 downstream_gene_variant ; 3638.0bp to feature; MODIFIER silent_mutation Average:45.017; most accessible tissue: Minghui63 flower, score: 56.131 N N N N
vg1123298102 G -> A LOC_Os11g39140.1 intron_variant ; MODIFIER silent_mutation Average:45.017; most accessible tissue: Minghui63 flower, score: 56.131 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123298102 NA 3.58E-07 mr1090 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123298102 6.91E-06 3.17E-08 mr1211 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123298102 NA 1.53E-07 mr1805 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123298102 NA 6.42E-08 mr1989 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251