Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123292846:

Variant ID: vg1123292846 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23292846
Reference Allele: A	Alternative Allele: G
Primary Allele: A	Secondary Allele: G

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AAACTCCTGACATGAGCTGCTCATTTCACCCATTTTTACATTAATGCCTTCAGTTTGATTAATTCTGAGCTCTTGCTGAAACATCGCAATGAACAGTTTT[A/G]
TAGACATCTAGTTAACTTTGTTCGGCTCAATAAATAAATGCCAATAAATTAACTTTGTTCGGCTCAATAAATAAATGCCAATTATATCAACCAAACTACC

Reverse complement sequence

GGTAGTTTGGTTGATATAATTGGCATTTATTTATTGAGCCGAACAAAGTTAATTTATTGGCATTTATTTATTGAGCCGAACAAAGTTAACTAGATGTCTA[T/C]
AAAACTGTTCATTGCGATGTTTCAGCAAGAGCTCAGAATTAATCAAACTGAAGGCATTAATGTAAAAATGGGTGAAATGAGCAGCTCATGTCAGGAGTTT

Allele Frequencies:

Populations	Population Size	Frequency of A(primary allele)	Frequency of G(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	88.30%	0.40%	6.24%	4.99%	NA
All Indica	2759	85.10%	0.50%	7.14%	7.25%	NA
All Japonica	1512	99.10%	0.10%	0.40%	0.33%	NA
Aus	269	78.10%	1.90%	18.59%	1.49%	NA
Indica I	595	95.10%	0.20%	1.18%	3.53%	NA
Indica II	465	98.90%	0.00%	0.65%	0.43%	NA
Indica III	913	66.00%	1.20%	16.76%	15.99%	NA
Indica Intermediate	786	91.60%	0.10%	4.33%	3.94%	NA
Temperate Japonica	767	99.70%	0.00%	0.26%	0.00%	NA
Tropical Japonica	504	99.60%	0.00%	0.20%	0.20%	NA
Japonica Intermediate	241	96.30%	0.80%	1.24%	1.66%	NA
VI/Aromatic	96	34.40%	1.00%	39.58%	25.00%	NA
Intermediate	90	92.20%	0.00%	4.44%	3.33%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123292846	A -> DEL	N	N	silent_mutation	Average:50.821; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg1123292846	A -> G	LOC_Os11g39140.1	upstream_gene_variant ; 2266.0bp to feature; MODIFIER	silent_mutation	Average:50.821; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg1123292846	A -> G	LOC_Os11g39130.3	downstream_gene_variant ; 110.0bp to feature; MODIFIER	silent_mutation	Average:50.821; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg1123292846	A -> G	LOC_Os11g39130.1	intron_variant ; MODIFIER	silent_mutation	Average:50.821; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N
vg1123292846	A -> G	LOC_Os11g39130.4	intron_variant ; MODIFIER	silent_mutation	Average:50.821; most accessible tissue: Zhenshan97 flower, score: 63.345	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123292846	6.10E-07	NA	mr1090_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123292846	1.20E-06	NA	mr1281_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251