\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123287295:

Variant ID: vg1123287295 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23287295
Reference Allele: TAlternative Allele: C,G
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GTTTATTTTTTAGTTTTTGCTTTTAGATCGCTAAAAGCGCGTATATAAAAGTTATATTTACAAATTACTTTTCGTTTATAAATATACCGTTTGGCTTATT[T/C,G]
CAAGATAATTTAAGTTGCTTTGCACGGACTGGATTGTATATAAAGCCTTTTGTTTACAAAAGCTAATTTAAGTTGCTTTTTGCTTACCTCGAAAGGACGA

Reverse complement sequence

TCGTCCTTTCGAGGTAAGCAAAAAGCAACTTAAATTAGCTTTTGTAAACAAAAGGCTTTATATACAATCCAGTCCGTGCAAAGCAACTTAAATTATCTTG[A/G,C]
AATAAGCCAAACGGTATATTTATAAACGAAAAGTAATTTGTAAATATAACTTTTATATACGCGCTTTTAGCGATCTAAAAGCAAAAACTAAAAAATAAAC

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.40% 18.50% 0.51% 9.63% G: 0.02%
All Indica  2759 67.10% 18.80% 0.72% 13.37% NA
All Japonica  1512 90.20% 8.80% 0.26% 0.73% NA
Aus  269 27.50% 70.60% 0.00% 1.86% NA
Indica I  595 66.90% 28.60% 0.17% 4.37% NA
Indica II  465 95.10% 3.90% 0.00% 1.08% NA
Indica III  913 51.60% 15.80% 1.64% 31.00% NA
Indica Intermediate  786 68.70% 23.80% 0.51% 7.00% NA
Temperate Japonica  767 88.00% 11.30% 0.39% 0.26% NA
Tropical Japonica  504 92.10% 7.30% 0.20% 0.40% NA
Japonica Intermediate  241 93.40% 3.70% 0.00% 2.90% NA
VI/Aromatic  96 16.70% 17.70% 0.00% 65.62% NA
Intermediate  90 75.60% 15.60% 0.00% 7.78% G: 1.11%

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123287295 T -> DEL N N silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> G LOC_Os11g39120.1 upstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> G LOC_Os11g39130.1 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> G LOC_Os11g39130.3 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> G LOC_Os11g39130.4 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> G LOC_Os11g39120-LOC_Os11g39130 intergenic_region ; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> C LOC_Os11g39120.1 upstream_gene_variant ; 2497.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> C LOC_Os11g39130.1 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> C LOC_Os11g39130.3 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> C LOC_Os11g39130.4 upstream_gene_variant ; 3759.0bp to feature; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N
vg1123287295 T -> C LOC_Os11g39120-LOC_Os11g39130 intergenic_region ; MODIFIER silent_mutation Average:57.3; most accessible tissue: Callus, score: 84.26 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123287295 NA 2.02E-09 mr1378_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123287295 NA 3.29E-09 mr1378_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123287295 NA 6.44E-07 mr1520_2 Ind_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251