\
| Variant ID: vg1123287295 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23287295 |
| Reference Allele: T | Alternative Allele: C,G |
| Primary Allele: T | Secondary Allele: C |
Inferred Ancestral Allele: Not determined.
GTTTATTTTTTAGTTTTTGCTTTTAGATCGCTAAAAGCGCGTATATAAAAGTTATATTTACAAATTACTTTTCGTTTATAAATATACCGTTTGGCTTATT[T/C,G]
CAAGATAATTTAAGTTGCTTTGCACGGACTGGATTGTATATAAAGCCTTTTGTTTACAAAAGCTAATTTAAGTTGCTTTTTGCTTACCTCGAAAGGACGA
TCGTCCTTTCGAGGTAAGCAAAAAGCAACTTAAATTAGCTTTTGTAAACAAAAGGCTTTATATACAATCCAGTCCGTGCAAAGCAACTTAAATTATCTTG[A/G,C]
AATAAGCCAAACGGTATATTTATAAACGAAAAGTAATTTGTAAATATAACTTTTATATACGCGCTTTTAGCGATCTAAAAGCAAAAACTAAAAAATAAAC
| Populations | Population Size | Frequency of T(primary allele) | Frequency of C(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.40% | 18.50% | 0.51% | 9.63% | G: 0.02% |
| All Indica | 2759 | 67.10% | 18.80% | 0.72% | 13.37% | NA |
| All Japonica | 1512 | 90.20% | 8.80% | 0.26% | 0.73% | NA |
| Aus | 269 | 27.50% | 70.60% | 0.00% | 1.86% | NA |
| Indica I | 595 | 66.90% | 28.60% | 0.17% | 4.37% | NA |
| Indica II | 465 | 95.10% | 3.90% | 0.00% | 1.08% | NA |
| Indica III | 913 | 51.60% | 15.80% | 1.64% | 31.00% | NA |
| Indica Intermediate | 786 | 68.70% | 23.80% | 0.51% | 7.00% | NA |
| Temperate Japonica | 767 | 88.00% | 11.30% | 0.39% | 0.26% | NA |
| Tropical Japonica | 504 | 92.10% | 7.30% | 0.20% | 0.40% | NA |
| Japonica Intermediate | 241 | 93.40% | 3.70% | 0.00% | 2.90% | NA |
| VI/Aromatic | 96 | 16.70% | 17.70% | 0.00% | 65.62% | NA |
| Intermediate | 90 | 75.60% | 15.60% | 0.00% | 7.78% | G: 1.11% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123287295 | T -> DEL | N | N | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> G | LOC_Os11g39120.1 | upstream_gene_variant ; 2497.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> G | LOC_Os11g39130.1 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> G | LOC_Os11g39130.3 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> G | LOC_Os11g39130.4 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> G | LOC_Os11g39120-LOC_Os11g39130 | intergenic_region ; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> C | LOC_Os11g39120.1 | upstream_gene_variant ; 2497.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> C | LOC_Os11g39130.1 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> C | LOC_Os11g39130.3 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> C | LOC_Os11g39130.4 | upstream_gene_variant ; 3759.0bp to feature; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| vg1123287295 | T -> C | LOC_Os11g39120-LOC_Os11g39130 | intergenic_region ; MODIFIER | silent_mutation | Average:57.3; most accessible tissue: Callus, score: 84.26 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123287295 | NA | 2.02E-09 | mr1378_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123287295 | NA | 3.29E-09 | mr1378_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123287295 | NA | 6.44E-07 | mr1520_2 | Ind_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |