Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123287295:

Variant ID: vg1123287295 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23287295
Reference Allele: T	Alternative Allele: C,G
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

GTTTATTTTTTAGTTTTTGCTTTTAGATCGCTAAAAGCGCGTATATAAAAGTTATATTTACAAATTACTTTTCGTTTATAAATATACCGTTTGGCTTATT[T/C,G]
CAAGATAATTTAAGTTGCTTTGCACGGACTGGATTGTATATAAAGCCTTTTGTTTACAAAAGCTAATTTAAGTTGCTTTTTGCTTACCTCGAAAGGACGA

Reverse complement sequence

TCGTCCTTTCGAGGTAAGCAAAAAGCAACTTAAATTAGCTTTTGTAAACAAAAGGCTTTATATACAATCCAGTCCGTGCAAAGCAACTTAAATTATCTTG[A/G,C]
AATAAGCCAAACGGTATATTTATAAACGAAAAGTAATTTGTAAATATAACTTTTATATACGCGCTTTTAGCGATCTAAAAGCAAAAACTAAAAAATAAAC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	71.40%	18.50%	0.51%	9.63%	G: 0.02%
All Indica	2759	67.10%	18.80%	0.72%	13.37%	NA
All Japonica	1512	90.20%	8.80%	0.26%	0.73%	NA
Aus	269	27.50%	70.60%	0.00%	1.86%	NA
Indica I	595	66.90%	28.60%	0.17%	4.37%	NA
Indica II	465	95.10%	3.90%	0.00%	1.08%	NA
Indica III	913	51.60%	15.80%	1.64%	31.00%	NA
Indica Intermediate	786	68.70%	23.80%	0.51%	7.00%	NA
Temperate Japonica	767	88.00%	11.30%	0.39%	0.26%	NA
Tropical Japonica	504	92.10%	7.30%	0.20%	0.40%	NA
Japonica Intermediate	241	93.40%	3.70%	0.00%	2.90%	NA
VI/Aromatic	96	16.70%	17.70%	0.00%	65.62%	NA
Intermediate	90	75.60%	15.60%	0.00%	7.78%	G: 1.11%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123287295	T -> DEL	N	N	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> G	LOC_Os11g39120.1	upstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> G	LOC_Os11g39130.1	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> G	LOC_Os11g39130.3	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> G	LOC_Os11g39130.4	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> G	LOC_Os11g39120-LOC_Os11g39130	intergenic_region ; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> C	LOC_Os11g39120.1	upstream_gene_variant ; 2497.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> C	LOC_Os11g39130.1	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> C	LOC_Os11g39130.3	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> C	LOC_Os11g39130.4	upstream_gene_variant ; 3759.0bp to feature; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N
vg1123287295	T -> C	LOC_Os11g39120-LOC_Os11g39130	intergenic_region ; MODIFIER	silent_mutation	Average:57.3; most accessible tissue: Callus, score: 84.26	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123287295	NA	2.02E-09	mr1378_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123287295	NA	3.29E-09	mr1378_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123287295	NA	6.44E-07	mr1520_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251