\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123278155:

Variant ID: vg1123278155 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23278155
Reference Allele: AAlternative Allele: G
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GAGTTATACACTCTCCCTAGGCCCCAGCCTTGTCGTTGGAGAATCGTTTTCGGAGGAGAAGGCTCTTGGACCCTTGACCTGCCTTGGTTGAATAAGCACT[A/G]
ATCCTAGCCCCCAGCCATGAAGTTGGAAAGCTCAGTTTCCGATTACACGGCTTGGTTAATCCGCACGGGGAGAACTTTTACACGACCAGGTCTTACATGG

Reverse complement sequence

CCATGTAAGACCTGGTCGTGTAAAAGTTCTCCCCGTGCGGATTAACCAAGCCGTGTAATCGGAAACTGAGCTTTCCAACTTCATGGCTGGGGGCTAGGAT[T/C]
AGTGCTTATTCAACCAAGGCAGGTCAAGGGTCCAAGAGCCTTCTCCTCCGAAAACGATTCTCCAACGACAAGGCTGGGGCCTAGGGAGAGTGTATAACTC

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 71.10% 13.40% 14.62% 0.91% NA
All Indica  2759 72.70% 2.90% 23.67% 0.72% NA
All Japonica  1512 65.80% 33.30% 0.60% 0.26% NA
Aus  269 97.80% 0.70% 1.49% 0.00% NA
Indica I  595 78.50% 3.00% 17.65% 0.84% NA
Indica II  465 93.30% 2.20% 4.30% 0.22% NA
Indica III  913 58.10% 3.00% 37.79% 1.20% NA
Indica Intermediate  786 73.20% 3.20% 23.28% 0.38% NA
Temperate Japonica  767 41.30% 58.10% 0.52% 0.00% NA
Tropical Japonica  504 92.70% 7.10% 0.00% 0.20% NA
Japonica Intermediate  241 87.60% 9.10% 2.07% 1.24% NA
VI/Aromatic  96 26.00% 39.60% 16.67% 17.71% NA
Intermediate  90 77.80% 10.00% 10.00% 2.22% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123278155 A -> DEL N N silent_mutation Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1123278155 A -> G LOC_Os11g39110.1 upstream_gene_variant ; 3131.0bp to feature; MODIFIER silent_mutation Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N
vg1123278155 A -> G LOC_Os11g39110-LOC_Os11g39120 intergenic_region ; MODIFIER silent_mutation Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123278155 9.14E-08 1.68E-30 mr1137 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 2.55E-13 mr1137 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 7.94E-06 mr1205 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 9.01E-07 mr1295 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 8.05E-06 mr1531 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 1.49E-07 mr1579 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 3.10E-08 7.66E-28 mr1617 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 2.89E-12 mr1617 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 3.34E-08 mr1627 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 6.26E-06 mr1763 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123278155 NA 5.91E-07 mr1627_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251