\
| Variant ID: vg1123278155 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23278155 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
GAGTTATACACTCTCCCTAGGCCCCAGCCTTGTCGTTGGAGAATCGTTTTCGGAGGAGAAGGCTCTTGGACCCTTGACCTGCCTTGGTTGAATAAGCACT[A/G]
ATCCTAGCCCCCAGCCATGAAGTTGGAAAGCTCAGTTTCCGATTACACGGCTTGGTTAATCCGCACGGGGAGAACTTTTACACGACCAGGTCTTACATGG
CCATGTAAGACCTGGTCGTGTAAAAGTTCTCCCCGTGCGGATTAACCAAGCCGTGTAATCGGAAACTGAGCTTTCCAACTTCATGGCTGGGGGCTAGGAT[T/C]
AGTGCTTATTCAACCAAGGCAGGTCAAGGGTCCAAGAGCCTTCTCCTCCGAAAACGATTCTCCAACGACAAGGCTGGGGCCTAGGGAGAGTGTATAACTC
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 71.10% | 13.40% | 14.62% | 0.91% | NA |
| All Indica | 2759 | 72.70% | 2.90% | 23.67% | 0.72% | NA |
| All Japonica | 1512 | 65.80% | 33.30% | 0.60% | 0.26% | NA |
| Aus | 269 | 97.80% | 0.70% | 1.49% | 0.00% | NA |
| Indica I | 595 | 78.50% | 3.00% | 17.65% | 0.84% | NA |
| Indica II | 465 | 93.30% | 2.20% | 4.30% | 0.22% | NA |
| Indica III | 913 | 58.10% | 3.00% | 37.79% | 1.20% | NA |
| Indica Intermediate | 786 | 73.20% | 3.20% | 23.28% | 0.38% | NA |
| Temperate Japonica | 767 | 41.30% | 58.10% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 92.70% | 7.10% | 0.00% | 0.20% | NA |
| Japonica Intermediate | 241 | 87.60% | 9.10% | 2.07% | 1.24% | NA |
| VI/Aromatic | 96 | 26.00% | 39.60% | 16.67% | 17.71% | NA |
| Intermediate | 90 | 77.80% | 10.00% | 10.00% | 2.22% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123278155 | A -> DEL | N | N | silent_mutation | Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg1123278155 | A -> G | LOC_Os11g39110.1 | upstream_gene_variant ; 3131.0bp to feature; MODIFIER | silent_mutation | Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| vg1123278155 | A -> G | LOC_Os11g39110-LOC_Os11g39120 | intergenic_region ; MODIFIER | silent_mutation | Average:46.25; most accessible tissue: Zhenshan97 flag leaf, score: 65.82 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123278155 | 9.14E-08 | 1.68E-30 | mr1137 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 2.55E-13 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 7.94E-06 | mr1205 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 9.01E-07 | mr1295 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 8.05E-06 | mr1531 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 1.49E-07 | mr1579 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | 3.10E-08 | 7.66E-28 | mr1617 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 2.89E-12 | mr1617 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 3.34E-08 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 6.26E-06 | mr1763 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123278155 | NA | 5.91E-07 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |