Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123212318:

Variant ID: vg1123212318 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 23212318
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACAGGTAGGACCAGGCCGCACCGCGCACGCGCTCCAGATTGTTGGGAGCCACGTCGGCCAGCGGCCTCCGCCGTCGAGCTTTTCCCCGTCAGCCAACAC[T/C]
ATTCTCCCTACCTATTGGCGGCTGTCCTGGAGGTTTGGGTTGTGATGGGAAGAAAGGGAACTGAGATGTAAAAAGATTGCCAAAAATTGTGAAATTGTGG

Reverse complement sequence

CCACAATTTCACAATTTTTGGCAATCTTTTTACATCTCAGTTCCCTTTCTTCCCATCACAACCCAAACCTCCAGGACAGCCGCCAATAGGTAGGGAGAAT[A/G]
GTGTTGGCTGACGGGGAAAAGCTCGACGGCGGAGGCCGCTGGCCGACGTGGCTCCCAACAATCTGGAGCGCGTGCGCGGTGCGGCCTGGTCCTACCTGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	65.20%	14.60%	4.51%	15.72%	NA
All Indica	2759	69.40%	1.20%	6.67%	22.69%	NA
All Japonica	1512	49.10%	42.60%	1.59%	6.75%	NA
Aus	269	99.30%	0.00%	0.00%	0.74%	NA
Indica I	595	82.70%	0.80%	6.89%	9.58%	NA
Indica II	465	48.80%	1.10%	12.26%	37.85%	NA
Indica III	913	75.70%	0.40%	3.61%	20.26%	NA
Indica Intermediate	786	64.20%	2.50%	6.74%	26.46%	NA
Temperate Japonica	767	22.80%	73.70%	0.91%	2.61%	NA
Tropical Japonica	504	81.50%	5.60%	1.98%	10.91%	NA
Japonica Intermediate	241	64.70%	21.20%	2.90%	11.20%	NA
VI/Aromatic	96	99.00%	0.00%	1.04%	0.00%	NA
Intermediate	90	66.70%	14.40%	4.44%	14.44%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1123212318	T -> DEL	N	N	silent_mutation	Average:92.212; most accessible tissue: Zhenshan97 flower, score: 95.312	N	N	N	N
vg1123212318	T -> C	LOC_Os11g38990.1	upstream_gene_variant ; 149.0bp to feature; MODIFIER	silent_mutation	Average:92.212; most accessible tissue: Zhenshan97 flower, score: 95.312	N	N	N	N
vg1123212318	T -> C	LOC_Os11g38990.3	upstream_gene_variant ; 149.0bp to feature; MODIFIER	silent_mutation	Average:92.212; most accessible tissue: Zhenshan97 flower, score: 95.312	N	N	N	N
vg1123212318	T -> C	LOC_Os11g38990.2	upstream_gene_variant ; 149.0bp to feature; MODIFIER	silent_mutation	Average:92.212; most accessible tissue: Zhenshan97 flower, score: 95.312	N	N	N	N
vg1123212318	T -> C	LOC_Os11g38980-LOC_Os11g38990	intergenic_region ; MODIFIER	silent_mutation	Average:92.212; most accessible tissue: Zhenshan97 flower, score: 95.312	N	N	N	N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID	Ref	Alt	Root (RT)	Young Leaf (YL)	Flag Leaf (FL)	Young Panicle (YP)	Lemma & Palea (LP)	Stamen & Pistil (SP)
vg1123212318	T	C	-0.11	-0.08	-0.07	-0.08	-0.11	-0.1

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1123212318	NA	1.36E-09	Heading_date	Jap_All	Not	Breeding signatures of rice improvement revealed by a genomic variation map from a large germplasm collection, Proc Natl Acad Sci USA, 112(39): E5411-E5419, PMID:26358652
vg1123212318	NA	4.28E-08	mr1156_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	6.88E-07	mr1330_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	1.79E-09	mr1338_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	2.25E-09	mr1454_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	3.02E-06	3.02E-06	mr1579_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	3.77E-06	mr1621_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	7.88E-14	mr1879_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123212318	NA	2.33E-08	mr1879_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251