\
| Variant ID: vg1123185842 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23185842 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
CTGTAGGGCTTCTTTCTATGTTATTGTTTGGTTCTTATGAACAACTATACTATCTACAGTGGTTTCTTTCTCTGTCAAGTGTTATGAACAAATTTATTAC[T/A]
TCATTGCAGATGGTAAGACATTCAAGAAGCCACGTCGCCCTTACGAGAAGGAGCGTCTTGATGCAGAGCTGAAGCTAGTGGGTGAGTATGGACTGAGGTG
CACCTCAGTCCATACTCACCCACTAGCTTCAGCTCTGCATCAAGACGCTCCTTCTCGTAAGGGCGACGTGGCTTCTTGAATGTCTTACCATCTGCAATGA[A/T]
GTAATAAATTTGTTCATAACACTTGACAGAGAAAGAAACCACTGTAGATAGTATAGTTGTTCATAAGAACCAAACAATAACATAGAAAGAAGCCCTACAG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 99.70% | 0.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 99.90% | 0.10% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123185842 | T -> A | LOC_Os11g38970.1 | upstream_gene_variant ; 3690.0bp to feature; MODIFIER | N | Average:17.484; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| vg1123185842 | T -> A | LOC_Os11g38959.1 | intron_variant ; MODIFIER | N | Average:17.484; most accessible tissue: Zhenshan97 flower, score: 32.793 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123185842 | NA | 2.34E-06 | mr1063 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | NA | 6.11E-11 | mr1137 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | NA | 4.56E-06 | mr1192 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | 5.29E-06 | 5.21E-12 | mr1617 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | NA | 9.49E-07 | mr1627 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | NA | 3.70E-06 | mr1617_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123185842 | NA | 4.83E-06 | mr1627_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |