\
| Variant ID: vg1123174932 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 23174932 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 318. )
AAATTTACAGTTAGTCATCATGGTACACTGACTTGCTGTTCCATTGTCTTTCCATCTTCTGTTTCTACAGGCTTCCTTTTTGGCCATCTATGAAATTGAT[C/T]
TTTATTTGCTGGCTTGTCTTGCCATACTTCAATGGTGCAGCCTTTGTGTACCAAAATTATGTGAGACCTATGTTTGTGAAGCACCAAATGGTTAACATTT
AAATGTTAACCATTTGGTGCTTCACAAACATAGGTCTCACATAATTTTGGTACACAAAGGCTGCACCATTGAAGTATGGCAAGACAAGCCAGCAAATAAA[G/A]
ATCAATTTCATAGATGGCCAAAAAGGAAGCCTGTAGAAACAGAAGATGGAAAGACAATGGAACAGCAAGTCAGTGTACCATGATGACTAACTGTAAATTT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.30% | 17.20% | 0.42% | 0.00% | NA |
| All Indica | 2759 | 89.70% | 9.90% | 0.33% | 0.00% | NA |
| All Japonica | 1512 | 64.30% | 35.10% | 0.66% | 0.00% | NA |
| Aus | 269 | 99.30% | 0.40% | 0.37% | 0.00% | NA |
| Indica I | 595 | 61.20% | 37.50% | 1.34% | 0.00% | NA |
| Indica II | 465 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 95.30% | 4.60% | 0.13% | 0.00% | NA |
| Temperate Japonica | 767 | 87.00% | 12.50% | 0.52% | 0.00% | NA |
| Tropical Japonica | 504 | 37.90% | 60.90% | 1.19% | 0.00% | NA |
| Japonica Intermediate | 241 | 47.30% | 52.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123174932 | C -> T | LOC_Os11g38920.2 | synonymous_variant ; p.Ile79Ile; LOW | synonymous_codon | Average:50.835; most accessible tissue: Callus, score: 82.579 | N | N | N | N |
| vg1123174932 | C -> T | LOC_Os11g38920.1 | synonymous_variant ; p.Ile4Ile; LOW | synonymous_codon | Average:50.835; most accessible tissue: Callus, score: 82.579 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123174932 | NA | 9.75E-09 | mr1022 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 3.55E-14 | mr1079 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 1.35E-06 | mr1156 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 7.64E-11 | mr1390 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 1.02E-11 | mr1490 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 4.14E-06 | mr1790 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 3.98E-06 | mr1835 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 4.53E-15 | mr1178_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123174932 | NA | 2.89E-13 | mr1390_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |