\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1123064286:

Variant ID: vg1123064286 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 23064286
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 0.62, T: 0.38, others allele: 0.00, population size: 105. )

Flanking Sequence (100 bp) in Reference Genome:


ATAAGGCTGCCGCCGTCATCGCCGGAGAACCGGAGGCCGGCGAGGTCAACGGCAGGATGGAACTGGAGCTCACCGATTACCCGGGCTCCGGCGCCAACGA[T/C]
CGGCACTCGCCATGGGGGCAGGAGAGGAGAAACTGAGCAGCAGCAGCAAAAAATCTTCAGAGAAAACTTCATCCATGGTCACTTTCTTCAGAGAGAAAAT

Reverse complement sequence

ATTTTCTCTCTGAAGAAAGTGACCATGGATGAAGTTTTCTCTGAAGATTTTTTGCTGCTGCTGCTCAGTTTCTCCTCTCCTGCCCCCATGGCGAGTGCCG[A/G]
TCGTTGGCGCCGGAGCCCGGGTAATCGGTGAGCTCCAGTTCCATCCTGCCGTTGACCTCGCCGGCCTCCGGTTCTCCGGCGATGACGGCGGCAGCCTTAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 58.90% 41.00% 0.13% 0.00% NA
All Indica  2759 79.60% 20.20% 0.18% 0.00% NA
All Japonica  1512 11.80% 88.20% 0.07% 0.00% NA
Aus  269 97.00% 3.00% 0.00% 0.00% NA
Indica I  595 56.60% 43.40% 0.00% 0.00% NA
Indica II  465 95.70% 3.70% 0.65% 0.00% NA
Indica III  913 79.20% 20.70% 0.11% 0.00% NA
Indica Intermediate  786 87.90% 12.00% 0.13% 0.00% NA
Temperate Japonica  767 6.80% 93.20% 0.00% 0.00% NA
Tropical Japonica  504 17.70% 82.30% 0.00% 0.00% NA
Japonica Intermediate  241 15.40% 84.20% 0.41% 0.00% NA
VI/Aromatic  96 89.60% 10.40% 0.00% 0.00% NA
Intermediate  90 68.90% 31.10% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1123064286 T -> C LOC_Os11g38790.1 synonymous_variant ; p.Asp84Asp; LOW synonymous_codon Average:86.657; most accessible tissue: Zhenshan97 root, score: 95.351 N N N N
vg1123064286 T -> C LOC_Os11g38790.2 synonymous_variant ; p.Asp67Asp; LOW synonymous_codon Average:86.657; most accessible tissue: Zhenshan97 root, score: 95.351 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1123064286 T C 0.0 0.02 0.02 0.01 0.01 -0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1123064286 NA 4.41E-08 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 1.84E-06 NA mr1395 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 6.08E-06 NA mr1613 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 5.40E-07 6.95E-10 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 NA 1.07E-09 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 NA 6.31E-06 mr1100_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1123064286 NA 5.12E-13 mr1553_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251