\
| Variant ID: vg1123001258 (JBrowse) | Variation Type: INDEL |
| Chromosome: chr11 | Position: 23001258 |
| Reference Allele: A | Alternative Allele: AGGATCGAATTACAAGAACTAAG,T,AGGATCGAATCACAAGAACTAAG,G |
| Primary Allele: A | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
GTTCATTATCCAAAAAATCCTCACTGTTCAAACACTGCCACTTGGTTGTGTGAACCTTTTGTAAGGAGTGAGTCTATGTACTCTAGTTTGGGTTTTAGAG[A/AGGATCGAATTACAAGAACTAAG,T,AGGATCGAATCACAAGAACTAAG,G]
CCAGGTTTAAATCCATTTTCCATTTTCATAAAAATCGAGCGATGAATACACCATTACCCTGGTCGCTTTCTCATGCATCCAGGCATGCATCACCAGCGTT
AACGCTGGTGATGCATGCCTGGATGCATGAGAAAGCGACCAGGGTAATGGTGTATTCATCGCTCGATTTTTATGAAAATGGAAAATGGATTTAAACCTGG[T/CTTAGTTCTTGTAATTCGATCCT,A,CTTAGTTCTTGTGATTCGATCCT,C]
CTCTAAAACCCAAACTAGAGTACATAGACTCACTCCTTACAAAAGGTTCACACAACCAAGTGGCAGTGTTTGAACAGTGAGGATTTTTTGGATAATGAAC
| Populations | Population Size | Frequency of A(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 53.90% | 3.20% | 21.69% | 18.81% | AGGATCGAATCACAAGAACTAAG: 2.22%; AGGATCGAATTACAAGAACTAAG: 0.17%; G: 0.02% |
| All Indica | 2759 | 40.40% | 4.30% | 24.14% | 27.69% | AGGATCGAATCACAAGAACTAAG: 3.12%; AGGATCGAATTACAAGAACTAAG: 0.29%; G: 0.04% |
| All Japonica | 1512 | 85.60% | 0.90% | 9.39% | 3.64% | AGGATCGAATCACAAGAACTAAG: 0.53% |
| Aus | 269 | 2.60% | 7.10% | 69.89% | 17.10% | AGGATCGAATCACAAGAACTAAG: 3.35% |
| Indica I | 595 | 81.50% | 1.30% | 7.23% | 8.40% | AGGATCGAATCACAAGAACTAAG: 1.51% |
| Indica II | 465 | 5.60% | 5.20% | 35.27% | 47.74% | AGGATCGAATCACAAGAACTAAG: 6.02%; AGGATCGAATTACAAGAACTAAG: 0.22% |
| Indica III | 913 | 36.50% | 5.60% | 28.48% | 26.62% | AGGATCGAATCACAAGAACTAAG: 2.52%; AGGATCGAATTACAAGAACTAAG: 0.33% |
| Indica Intermediate | 786 | 34.60% | 4.50% | 25.32% | 31.68% | AGGATCGAATCACAAGAACTAAG: 3.31%; AGGATCGAATTACAAGAACTAAG: 0.51%; G: 0.13% |
| Temperate Japonica | 767 | 91.10% | 0.30% | 4.69% | 3.65% | AGGATCGAATCACAAGAACTAAG: 0.26% |
| Tropical Japonica | 504 | 81.20% | 0.60% | 14.48% | 2.78% | AGGATCGAATCACAAGAACTAAG: 0.99% |
| Japonica Intermediate | 241 | 77.20% | 3.30% | 13.69% | 5.39% | AGGATCGAATCACAAGAACTAAG: 0.41% |
| VI/Aromatic | 96 | 90.60% | 1.00% | 6.25% | 2.08% | NA |
| Intermediate | 90 | 46.70% | 1.10% | 25.56% | 24.44% | AGGATCGAATCACAAGAACTAAG: 2.22% |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1123001258 | A -> AGGATCGAATTACAAGAACTAAG | LOC_Os11g38720-LOC_Os11g38750 | intergenic_region ; MODIFIER | silent_mutation | Average:54.637; most accessible tissue: Callus, score: 78.946 | N | N | N | N |
| vg1123001258 | A -> T | LOC_Os11g38720-LOC_Os11g38750 | intergenic_region ; MODIFIER | silent_mutation | Average:54.637; most accessible tissue: Callus, score: 78.946 | N | N | N | N |
| vg1123001258 | A -> AGGATCGAATCACAAGAACTAAG | LOC_Os11g38720-LOC_Os11g38750 | intergenic_region ; MODIFIER | silent_mutation | Average:54.637; most accessible tissue: Callus, score: 78.946 | N | N | N | N |
| vg1123001258 | A -> DEL | N | N | silent_mutation | Average:54.637; most accessible tissue: Callus, score: 78.946 | N | N | N | N |
| vg1123001258 | A -> G | LOC_Os11g38720-LOC_Os11g38750 | intergenic_region ; MODIFIER | silent_mutation | Average:54.637; most accessible tissue: Callus, score: 78.946 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1123001258 | NA | 1.82E-06 | mr1074 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 5.05E-06 | mr1130 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 1.22E-07 | mr1272 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 3.52E-06 | mr1542 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 5.20E-11 | mr1659 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 6.66E-10 | mr1935 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 1.39E-06 | mr1942 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 8.34E-06 | mr1050_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 7.95E-06 | mr1169_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 2.57E-09 | mr1565_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 3.48E-10 | mr1715_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 1.43E-06 | mr1842_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 5.44E-09 | mr1902_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 2.11E-06 | mr1923_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 1.03E-08 | mr1933_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1123001258 | NA | 8.18E-08 | mr1942_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |