\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122987844:

Variant ID: vg1122987844 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22987844
Reference Allele: AAlternative Allele: T
Primary Allele: ASecondary Allele: T

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.76, T: 0.24, others allele: 0.00, population size: 92. )

Flanking Sequence (100 bp) in Reference Genome:


ACTATGAAATACACTGCTAACTAGCTCGTAGTGACAGCAGAGACATAATGATATTGTGTCTCTGTGTAGGATGTACAATACTAAATGCATATTTGCAACT[A/T]
AAACAAGCTAGTGTGCTTTAGTAGTGCTTAATTAAATATGAGTAAATTTCAGAAAGCTCCGGGTTTTCAATTATAACCACATTTTGGTGTGTTCAATCAT

Reverse complement sequence

ATGATTGAACACACCAAAATGTGGTTATAATTGAAAACCCGGAGCTTTCTGAAATTTACTCATATTTAATTAAGCACTACTAAAGCACACTAGCTTGTTT[T/A]
AGTTGCAAATATGCATTTAGTATTGTACATCCTACACAGAGACACAATATCATTATGTCTCTGCTGTCACTACGAGCTAGTTAGCAGTGTATTTCATAGT

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 46.10% 40.40% 3.94% 9.59% NA
All Indica  2759 27.40% 51.60% 5.98% 15.01% NA
All Japonica  1512 89.70% 8.80% 0.73% 0.79% NA
Aus  269 9.30% 83.60% 1.12% 5.95% NA
Indica I  595 69.90% 24.90% 1.68% 3.53% NA
Indica II  465 3.90% 59.80% 6.02% 30.32% NA
Indica III  913 14.50% 66.20% 6.13% 13.25% NA
Indica Intermediate  786 24.20% 50.10% 9.03% 16.67% NA
Temperate Japonica  767 91.40% 5.90% 1.17% 1.56% NA
Tropical Japonica  504 86.90% 12.90% 0.20% 0.00% NA
Japonica Intermediate  241 90.00% 9.50% 0.41% 0.00% NA
VI/Aromatic  96 10.40% 87.50% 0.00% 2.08% NA
Intermediate  90 36.70% 45.60% 7.78% 10.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122987844 A -> T LOC_Os11g38720.1 downstream_gene_variant ; 4278.0bp to feature; MODIFIER silent_mutation Average:44.673; most accessible tissue: Callus, score: 75.808 N N N N
vg1122987844 A -> T LOC_Os11g38720-LOC_Os11g38750 intergenic_region ; MODIFIER silent_mutation Average:44.673; most accessible tissue: Callus, score: 75.808 N N N N
vg1122987844 A -> DEL N N silent_mutation Average:44.673; most accessible tissue: Callus, score: 75.808 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122987844 NA 1.10E-14 mr1170 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.35E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.29E-06 mr1291 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 4.35E-19 mr1557 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 5.15E-08 mr1587 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.43E-08 mr1659 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.25E-06 mr1169_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.69E-09 mr1170_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 8.24E-06 mr1201_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 3.11E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 2.71E-23 mr1557_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.10E-06 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 3.18E-06 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 2.75E-06 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122987844 NA 1.33E-08 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251