Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122981002:

Variant ID: vg1122981002 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22981002
Reference Allele: T	Alternative Allele: C
Primary Allele: T	Secondary Allele: C

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.99, C: 0.01, others allele: 0.00, population size: 119. )

Flanking Sequence (100 bp) in Reference Genome:

GGACATTTGTAAATTGGGTACAATATGATCAATTGTAATGTATGACTTGCCTTGCTCTCGCACTGATGAGGCCACAGCAAAGTCTTCGAGAAACCGCGGA[T/C]
CGACGAAACGGCCGAAATCTACGCGACAAACAAAGCACACAAGCAAAACAGGCTATAAGACTACTGAAACAGGAAACAAAACCATTTTTAATGGATTCTA

Reverse complement sequence

TAGAATCCATTAAAAATGGTTTTGTTTCCTGTTTCAGTAGTCTTATAGCCTGTTTTGCTTGTGTGCTTTGTTTGTCGCGTAGATTTCGGCCGTTTCGTCG[A/G]
TCCGCGGTTTCTCGAAGACTTTGCTGTGGCCTCATCAGTGCGAGAGCAAGGCAAGTCATACATTACAATTGATCATATTGTACCCAATTTACAAATGTCC

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of C(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.80%	9.70%	5.40%	1.16%	NA
All Indica	2759	82.60%	7.50%	8.16%	1.74%	NA
All Japonica	1512	88.80%	10.50%	0.66%	0.07%	NA
Aus	269	65.40%	27.10%	5.20%	2.23%	NA
Indica I	595	92.90%	0.80%	6.05%	0.17%	NA
Indica II	465	68.80%	17.00%	9.25%	4.95%	NA
Indica III	913	83.20%	7.90%	8.21%	0.66%	NA
Indica Intermediate	786	82.10%	6.60%	9.03%	2.29%	NA
Temperate Japonica	767	95.40%	3.80%	0.78%	0.00%	NA
Tropical Japonica	504	82.90%	16.50%	0.40%	0.20%	NA
Japonica Intermediate	241	79.70%	19.50%	0.83%	0.00%	NA
VI/Aromatic	96	93.80%	4.20%	2.08%	0.00%	NA
Intermediate	90	81.10%	14.40%	4.44%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122981002	T -> DEL	N	N	silent_mutation	Average:27.816; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N
vg1122981002	T -> C	LOC_Os11g38720.1	intron_variant ; MODIFIER	silent_mutation	Average:27.816; most accessible tissue: Zhenshan97 flag leaf, score: 55.285	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122981002	NA	3.90E-08	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122981002	2.21E-07	2.21E-07	mr1584_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122981002	NA	2.59E-06	mr1607_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122981002	NA	1.48E-06	mr1668_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122981002	NA	8.05E-06	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251