\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122976068:

Variant ID: vg1122976068 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22976068
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ACACATCATGCTGTTAGGTTGAAGATATATTTTTTTTAGATAATGGAGGTTGTCAGTGATATGGGCCCGGGGTACGCAAGATAGAGTGAAAGAATCTTTC[T/C]
GTCTGACCACGTGGCCGCGCGACCTATTACCCCCCTTGGGGGAGAGCGAGCGGTCGTGAGGCGGCCAAGCGGCCTCGGGGTGCCCTGCCGCACCCCTCGG

Reverse complement sequence

CCGAGGGGTGCGGCAGGGCACCCCGAGGCCGCTTGGCCGCCTCACGACCGCTCGCTCTCCCCCAAGGGGGGTAATAGGTCGCGCGGCCACGTGGTCAGAC[A/G]
GAAAGATTCTTTCACTCTATCTTGCGTACCCCGGGCCCATATCACTGACAACCTCCATTATCTAAAAAAAATATATCTTCAACCTAACAGCATGATGTGT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.40% 18.50% 0.04% 0.00% NA
All Indica  2759 98.90% 1.00% 0.07% 0.00% NA
All Japonica  1512 45.40% 54.60% 0.00% 0.00% NA
Aus  269 98.90% 1.10% 0.00% 0.00% NA
Indica I  595 99.50% 0.50% 0.00% 0.00% NA
Indica II  465 99.10% 0.90% 0.00% 0.00% NA
Indica III  913 98.90% 1.00% 0.11% 0.00% NA
Indica Intermediate  786 98.50% 1.40% 0.13% 0.00% NA
Temperate Japonica  767 51.00% 49.00% 0.00% 0.00% NA
Tropical Japonica  504 39.50% 60.50% 0.00% 0.00% NA
Japonica Intermediate  241 40.20% 59.80% 0.00% 0.00% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 76.70% 23.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122976068 T -> C LOC_Os11g38700.1 upstream_gene_variant ; 4461.0bp to feature; MODIFIER silent_mutation Average:75.145; most accessible tissue: Callus, score: 94.252 N N N N
vg1122976068 T -> C LOC_Os11g38720.1 upstream_gene_variant ; 3403.0bp to feature; MODIFIER silent_mutation Average:75.145; most accessible tissue: Callus, score: 94.252 N N N N
vg1122976068 T -> C LOC_Os11g38710.1 downstream_gene_variant ; 1812.0bp to feature; MODIFIER silent_mutation Average:75.145; most accessible tissue: Callus, score: 94.252 N N N N
vg1122976068 T -> C LOC_Os11g38710-LOC_Os11g38720 intergenic_region ; MODIFIER silent_mutation Average:75.145; most accessible tissue: Callus, score: 94.252 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122976068 NA 1.32E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122976068 NA 6.54E-08 mr1462_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122976068 NA 7.50E-06 mr1470_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122976068 NA 4.75E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251