\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122958660:

Variant ID: vg1122958660 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22958660
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


GCGGCTCTCTTAAGAGGCCCGTATGGGAAAAATCGATTTTTTCATACAGGCCACTTAAGCAGCCGTTTGGGAAAATGAGCCTCGATTTTTACAGACGCCA[T/C]
TAGTTATGGTCCGTTTGCAAAAATCATGGGGCCTCGTACAGAAAAATCACTTTTGTAGTAGTAAGTACTACTTATCTCATCAATCACATCTCATTCAAAT

Reverse complement sequence

ATTTGAATGAGATGTGATTGATGAGATAAGTAGTACTTACTACTACAAAAGTGATTTTTCTGTACGAGGCCCCATGATTTTTGCAAACGGACCATAACTA[A/G]
TGGCGTCTGTAAAAATCGAGGCTCATTTTCCCAAACGGCTGCTTAAGTGGCCTGTATGAAAAAATCGATTTTTCCCATACGGGCCTCTTAAGAGAGCCGC

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.50% 24.80% 0.04% 2.64% NA
All Indica  2759 97.60% 2.30% 0.04% 0.07% NA
All Japonica  1512 20.60% 71.30% 0.07% 8.07% NA
Aus  269 96.70% 3.30% 0.00% 0.00% NA
Indica I  595 98.00% 2.00% 0.00% 0.00% NA
Indica II  465 98.70% 0.90% 0.22% 0.22% NA
Indica III  913 97.40% 2.60% 0.00% 0.00% NA
Indica Intermediate  786 96.80% 3.10% 0.00% 0.13% NA
Temperate Japonica  767 17.20% 79.80% 0.00% 3.00% NA
Tropical Japonica  504 20.80% 62.70% 0.20% 16.27% NA
Japonica Intermediate  241 30.70% 62.20% 0.00% 7.05% NA
VI/Aromatic  96 100.00% 0.00% 0.00% 0.00% NA
Intermediate  90 74.40% 24.40% 0.00% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122958660 T -> DEL N N silent_mutation Average:34.181; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1122958660 T -> C LOC_Os11g38670.1 downstream_gene_variant ; 3972.0bp to feature; MODIFIER silent_mutation Average:34.181; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1122958660 T -> C LOC_Os11g38680.1 downstream_gene_variant ; 533.0bp to feature; MODIFIER silent_mutation Average:34.181; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1122958660 T -> C LOC_Os11g38690.1 downstream_gene_variant ; 3386.0bp to feature; MODIFIER silent_mutation Average:34.181; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N
vg1122958660 T -> C LOC_Os11g38680-LOC_Os11g38690 intergenic_region ; MODIFIER silent_mutation Average:34.181; most accessible tissue: Minghui63 panicle, score: 71.773 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122958660 NA 4.27E-06 mr1913 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 4.24E-07 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 1.22E-18 mr1062_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 6.22E-06 mr1066_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.05E-30 mr1102_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 5.97E-07 NA mr1127_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.91E-07 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.39E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 9.28E-11 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.90E-18 mr1239_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.45E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.06E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 1.64E-06 NA mr1403_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.07E-06 mr1405_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.42E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.12E-17 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.44E-06 mr1574_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 4.54E-17 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.51E-08 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 1.09E-11 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.13E-15 mr1726_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.42E-10 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 4.73E-15 mr1767_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 1.56E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 3.65E-07 mr1885_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 5.83E-09 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 4.32E-08 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 NA 2.97E-09 mr1940_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958660 3.38E-06 1.69E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251