\
| Variant ID: vg1122958251 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22958251 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
AGCCTCAGCGGTGGTGGTGACGACAGCCGACAGAAATGACCAATCACTTTGTCGGATGAAGAAATGATCAAAATAGAAGTTATAGATCTTGATGATTATA[T/C]
AACTTTGTTATTGATGACTTTTTCAGATGAAATTATTTACTGCTTCAAAATATTATTTGAAGTTTTGAAATTCAAATTTTTAATTGATAAAACAAAGCCA
TGGCTTTGTTTTATCAATTAAAAATTTGAATTTCAAAACTTCAAATAATATTTTGAAGCAGTAAATAATTTCATCTGAAAAAGTCATCAATAACAAAGTT[A/G]
TATAATCATCAAGATCTATAACTTCTATTTTGATCATTTCTTCATCCGACAAAGTGATTGGTCATTTCTGTCGGCTGTCGTCACCACCACCGCTGAGGCT
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 72.20% | 25.00% | 0.11% | 2.67% | NA |
| All Indica | 2759 | 97.60% | 2.20% | 0.04% | 0.11% | NA |
| All Japonica | 1512 | 20.00% | 71.80% | 0.07% | 8.07% | NA |
| Aus | 269 | 94.80% | 4.80% | 0.37% | 0.00% | NA |
| Indica I | 595 | 99.70% | 0.30% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.50% | 1.30% | 0.00% | 0.22% | NA |
| Indica III | 913 | 96.90% | 3.00% | 0.11% | 0.00% | NA |
| Indica Intermediate | 786 | 96.40% | 3.30% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 16.30% | 80.70% | 0.00% | 3.00% | NA |
| Tropical Japonica | 504 | 21.00% | 62.50% | 0.20% | 16.27% | NA |
| Japonica Intermediate | 241 | 29.90% | 63.10% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 99.00% | 1.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 72.20% | 24.40% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122958251 | T -> DEL | N | N | silent_mutation | Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1122958251 | T -> C | LOC_Os11g38670.1 | downstream_gene_variant ; 3563.0bp to feature; MODIFIER | silent_mutation | Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1122958251 | T -> C | LOC_Os11g38680.1 | downstream_gene_variant ; 124.0bp to feature; MODIFIER | silent_mutation | Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1122958251 | T -> C | LOC_Os11g38690.1 | downstream_gene_variant ; 3795.0bp to feature; MODIFIER | silent_mutation | Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| vg1122958251 | T -> C | LOC_Os11g38680-LOC_Os11g38690 | intergenic_region ; MODIFIER | silent_mutation | Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122958251 | NA | 3.28E-08 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | 9.01E-06 | NA | mr1111_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | 7.18E-06 | NA | mr1127_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 2.79E-06 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 3.21E-09 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 1.09E-09 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 3.56E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 2.77E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 6.91E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 1.42E-16 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 6.03E-16 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 5.70E-08 | mr1659_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 5.23E-09 | mr1660_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | 2.06E-06 | NA | mr1676_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 2.42E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 5.37E-12 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 4.65E-09 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 2.85E-09 | mr1835_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 6.30E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 7.45E-13 | mr1904_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 1.18E-07 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 2.24E-07 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 3.75E-18 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958251 | NA | 5.54E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |