\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122958251:

Variant ID: vg1122958251 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22958251
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AGCCTCAGCGGTGGTGGTGACGACAGCCGACAGAAATGACCAATCACTTTGTCGGATGAAGAAATGATCAAAATAGAAGTTATAGATCTTGATGATTATA[T/C]
AACTTTGTTATTGATGACTTTTTCAGATGAAATTATTTACTGCTTCAAAATATTATTTGAAGTTTTGAAATTCAAATTTTTAATTGATAAAACAAAGCCA

Reverse complement sequence

TGGCTTTGTTTTATCAATTAAAAATTTGAATTTCAAAACTTCAAATAATATTTTGAAGCAGTAAATAATTTCATCTGAAAAAGTCATCAATAACAAAGTT[A/G]
TATAATCATCAAGATCTATAACTTCTATTTTGATCATTTCTTCATCCGACAAAGTGATTGGTCATTTCTGTCGGCTGTCGTCACCACCACCGCTGAGGCT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 72.20% 25.00% 0.11% 2.67% NA
All Indica  2759 97.60% 2.20% 0.04% 0.11% NA
All Japonica  1512 20.00% 71.80% 0.07% 8.07% NA
Aus  269 94.80% 4.80% 0.37% 0.00% NA
Indica I  595 99.70% 0.30% 0.00% 0.00% NA
Indica II  465 98.50% 1.30% 0.00% 0.22% NA
Indica III  913 96.90% 3.00% 0.11% 0.00% NA
Indica Intermediate  786 96.40% 3.30% 0.00% 0.25% NA
Temperate Japonica  767 16.30% 80.70% 0.00% 3.00% NA
Tropical Japonica  504 21.00% 62.50% 0.20% 16.27% NA
Japonica Intermediate  241 29.90% 63.10% 0.00% 7.05% NA
VI/Aromatic  96 99.00% 1.00% 0.00% 0.00% NA
Intermediate  90 72.20% 24.40% 2.22% 1.11% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122958251 T -> DEL N N silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1122958251 T -> C LOC_Os11g38670.1 downstream_gene_variant ; 3563.0bp to feature; MODIFIER silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1122958251 T -> C LOC_Os11g38680.1 downstream_gene_variant ; 124.0bp to feature; MODIFIER silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1122958251 T -> C LOC_Os11g38690.1 downstream_gene_variant ; 3795.0bp to feature; MODIFIER silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N
vg1122958251 T -> C LOC_Os11g38680-LOC_Os11g38690 intergenic_region ; MODIFIER silent_mutation Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122958251 NA 3.28E-08 mr1020_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 9.01E-06 NA mr1111_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 7.18E-06 NA mr1127_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 2.79E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 3.21E-09 mr1198_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 1.09E-09 mr1232_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 3.56E-06 mr1262_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 2.77E-07 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 6.91E-06 mr1407_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 1.42E-16 mr1557_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 6.03E-16 mr1575_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 5.70E-08 mr1659_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 5.23E-09 mr1660_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 2.06E-06 NA mr1676_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 2.42E-07 mr1676_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 5.37E-12 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 4.65E-09 mr1765_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 2.85E-09 mr1835_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 6.30E-06 mr1869_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 7.45E-13 mr1904_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 1.18E-07 mr1909_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 2.24E-07 mr1921_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 3.75E-18 mr1980_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251 NA 5.54E-06 mr1980_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251