Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122958251:

Variant ID: vg1122958251 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22958251
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

AGCCTCAGCGGTGGTGGTGACGACAGCCGACAGAAATGACCAATCACTTTGTCGGATGAAGAAATGATCAAAATAGAAGTTATAGATCTTGATGATTATA[T/C]
AACTTTGTTATTGATGACTTTTTCAGATGAAATTATTTACTGCTTCAAAATATTATTTGAAGTTTTGAAATTCAAATTTTTAATTGATAAAACAAAGCCA

Reverse complement sequence

TGGCTTTGTTTTATCAATTAAAAATTTGAATTTCAAAACTTCAAATAATATTTTGAAGCAGTAAATAATTTCATCTGAAAAAGTCATCAATAACAAAGTT[A/G]
TATAATCATCAAGATCTATAACTTCTATTTTGATCATTTCTTCATCCGACAAAGTGATTGGTCATTTCTGTCGGCTGTCGTCACCACCACCGCTGAGGCT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	72.20%	25.00%	0.11%	2.67%	NA
All Indica	2759	97.60%	2.20%	0.04%	0.11%	NA
All Japonica	1512	20.00%	71.80%	0.07%	8.07%	NA
Aus	269	94.80%	4.80%	0.37%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	98.50%	1.30%	0.00%	0.22%	NA
Indica III	913	96.90%	3.00%	0.11%	0.00%	NA
Indica Intermediate	786	96.40%	3.30%	0.00%	0.25%	NA
Temperate Japonica	767	16.30%	80.70%	0.00%	3.00%	NA
Tropical Japonica	504	21.00%	62.50%	0.20%	16.27%	NA
Japonica Intermediate	241	29.90%	63.10%	0.00%	7.05%	NA
VI/Aromatic	96	99.00%	1.00%	0.00%	0.00%	NA
Intermediate	90	72.20%	24.40%	2.22%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122958251	T -> DEL	N	N	silent_mutation	Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1122958251	T -> C	LOC_Os11g38670.1	downstream_gene_variant ; 3563.0bp to feature; MODIFIER	silent_mutation	Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1122958251	T -> C	LOC_Os11g38680.1	downstream_gene_variant ; 124.0bp to feature; MODIFIER	silent_mutation	Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1122958251	T -> C	LOC_Os11g38690.1	downstream_gene_variant ; 3795.0bp to feature; MODIFIER	silent_mutation	Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N
vg1122958251	T -> C	LOC_Os11g38680-LOC_Os11g38690	intergenic_region ; MODIFIER	silent_mutation	Average:39.739; most accessible tissue: Minghui63 panicle, score: 62.157	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122958251	NA	3.28E-08	mr1020_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	9.01E-06	NA	mr1111_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	7.18E-06	NA	mr1127_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	2.79E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	3.21E-09	mr1198_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	1.09E-09	mr1232_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	3.56E-06	mr1262_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	2.77E-07	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	6.91E-06	mr1407_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	1.42E-16	mr1557_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	6.03E-16	mr1575_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	5.70E-08	mr1659_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	5.23E-09	mr1660_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	2.06E-06	NA	mr1676_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	2.42E-07	mr1676_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	5.37E-12	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	4.65E-09	mr1765_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	2.85E-09	mr1835_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	6.30E-06	mr1869_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	7.45E-13	mr1904_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	1.18E-07	mr1909_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	2.24E-07	mr1921_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	3.75E-18	mr1980_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122958251	NA	5.54E-06	mr1980_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251