\
| Variant ID: vg1122958019 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22958019 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGGGGAGGGAGCCCGTCATGGCTCTCTCGCGGCCGGATCCGCCGCCCGCGGCCCAGCAGCGGTCGCGTCGTCGTCGCGGCAGCCTCCCCCATAGTAGCGG[T/C]
AGTGGATCCGACCTCCCCTGTCATGGTGGCTGCAGATCGGGCTTCCCCCGTCATCACGATGCCGGATCCGGCCTCCCCCGTCGTCGTGGCGGCTGGATCC
GGATCCAGCCGCCACGACGACGGGGGAGGCCGGATCCGGCATCGTGATGACGGGGGAAGCCCGATCTGCAGCCACCATGACAGGGGAGGTCGGATCCACT[A/G]
CCGCTACTATGGGGGAGGCTGCCGCGACGACGACGCGACCGCTGCTGGGCCGCGGGCGGCGGATCCGGCCGCGAGAGAGCCATGACGGGCTCCCTCCCCG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 73.40% | 23.90% | 0.02% | 2.71% | NA |
| All Indica | 2759 | 98.90% | 1.00% | 0.00% | 0.11% | NA |
| All Japonica | 1512 | 20.50% | 71.20% | 0.07% | 8.20% | NA |
| Aus | 269 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.50% | 0.50% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.90% | 0.90% | 0.00% | 0.22% | NA |
| Indica III | 913 | 98.80% | 1.20% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.30% | 0.00% | 0.25% | NA |
| Temperate Japonica | 767 | 17.20% | 79.80% | 0.00% | 3.00% | NA |
| Tropical Japonica | 504 | 20.60% | 62.50% | 0.20% | 16.67% | NA |
| Japonica Intermediate | 241 | 30.70% | 62.20% | 0.00% | 7.05% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 75.60% | 23.30% | 0.00% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122958019 | T -> DEL | LOC_Os11g38680.1 | N | frameshift_variant | Average:67.355; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| vg1122958019 | T -> C | LOC_Os11g38680.1 | synonymous_variant ; p.Gly130Gly; LOW | synonymous_codon | Average:67.355; most accessible tissue: Minghui63 panicle, score: 75.788 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122958019 | NA | 1.95E-08 | mr1020_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 5.48E-06 | mr1066_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | 1.26E-06 | NA | mr1127_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 6.37E-07 | mr1153_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 1.01E-08 | mr1198_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 8.66E-11 | mr1232_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 5.55E-06 | mr1262_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 2.90E-07 | mr1275_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 9.21E-06 | mr1407_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 7.21E-06 | mr1462_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 9.03E-17 | mr1557_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 1.03E-15 | mr1575_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 7.13E-11 | mr1714_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 6.07E-16 | mr1726_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 1.91E-10 | mr1765_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 4.35E-06 | mr1869_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 1.19E-08 | mr1909_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 8.08E-08 | mr1921_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 2.02E-19 | mr1922_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | NA | 2.12E-09 | mr1940_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122958019 | 4.33E-06 | 5.27E-19 | mr1980_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |