\
| Variant ID: vg1122942389 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22942389 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele: Not determined.
ATCCAATAGCACTACCACTGAAATATGTGAACCATCTATTGCTCCAATCGCATCTTTAAAGTATGGCCAAAATCGATCCTCTCTCAACCTTCCATGCTCC[A/G]
TAGAAAAAGTAGGATCTCTAGGAGTAATATTGTCTTTAGCTAACTTGCGCAAACACTTCAACACTTCATGAAACTTGGTGTGAACCGTCCAAAGTGACCG
CGGTCACTTTGGACGGTTCACACCAAGTTTCATGAAGTGTTGAAGTGTTTGCGCAAGTTAGCTAAAGACAATATTACTCCTAGAGATCCTACTTTTTCTA[T/C]
GGAGCATGGAAGGTTGAGAGAGGATCGATTTTGGCCATACTTTAAAGATGCGATTGGAGCAATAGATGGTTCACATATTTCAGTGGTAGTGCTATTGGAT
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 82.80% | 15.70% | 1.02% | 0.40% | NA |
| All Indica | 2759 | 98.50% | 1.10% | 0.36% | 0.04% | NA |
| All Japonica | 1512 | 51.70% | 44.90% | 2.25% | 1.12% | NA |
| Aus | 269 | 92.20% | 7.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 99.20% | 0.80% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.30% | 0.43% | 0.00% | NA |
| Indica III | 913 | 98.80% | 0.70% | 0.55% | 0.00% | NA |
| Indica Intermediate | 786 | 97.80% | 1.70% | 0.38% | 0.13% | NA |
| Temperate Japonica | 767 | 62.80% | 34.20% | 2.87% | 0.13% | NA |
| Tropical Japonica | 504 | 40.70% | 55.60% | 1.59% | 2.18% | NA |
| Japonica Intermediate | 241 | 39.40% | 56.80% | 1.66% | 2.07% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 78.90% | 17.80% | 2.22% | 1.11% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122942389 | A -> DEL | LOC_Os11g38660.1 | N | frameshift_variant | Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 | N | N | N | N |
| vg1122942389 | A -> G | LOC_Os11g38660.1 | missense_variant ; p.Met410Thr; MODERATE | nonsynonymous_codon ; M410T | Average:16.177; most accessible tissue: Zhenshan97 flag leaf, score: 21.748 | benign |
-0.705 |
TOLERATED | 1.00 |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122942389 | NA | 2.24E-06 | mr1991 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | NA | 1.67E-06 | mr1479_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | NA | 2.02E-06 | mr1574_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | NA | 6.77E-09 | mr1668_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | NA | 3.43E-06 | mr1780_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | NA | 3.38E-07 | mr1824_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122942389 | 1.05E-06 | NA | mr1849_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |