Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122937279:

Variant ID: vg1122937279 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22937279
Reference Allele: C	Alternative Allele: G,T
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TGAATGATTGAATCCTATCCACTACTCTATTTCTCCTAAATATTCCCATGTTATTTATGTAAACAGCTGACAACTACGTACTAACATACTCCCTCAATCC[C/G,T]
ATAAAAAACCAACCTAATACTACATGTAACATATCCTACTACTACGAATCTAGACATACATATGTATCCAGATTCATCGTATTAGAATATGTCATATCCG

Reverse complement sequence

CGGATATGACATATTCTAATACGATGAATCTGGATACATATGTATGTCTAGATTCGTAGTAGTAGGATATGTTACATGTAGTATTAGGTTGGTTTTTTAT[G/C,A]
GGATTGAGGGAGTATGTTAGTACGTAGTTGTCAGCTGTTTACATAAATAACATGGGAATATTTAGGAGAAATAGAGTAGTGGATAGGATTCAATCATTCA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	91.40%	5.80%	0.17%	0.00%	G: 2.67%
All Indica	2759	90.90%	4.70%	0.11%	0.00%	G: 4.24%
All Japonica	1512	91.50%	8.10%	0.33%	0.00%	G: 0.13%
Aus	269	94.10%	5.60%	0.00%	0.00%	G: 0.37%
Indica I	595	93.60%	6.20%	0.00%	0.00%	G: 0.17%
Indica II	465	96.80%	1.90%	0.00%	0.00%	G: 1.29%
Indica III	913	87.10%	5.10%	0.22%	0.00%	G: 7.56%
Indica Intermediate	786	89.90%	4.70%	0.13%	0.00%	G: 5.22%
Temperate Japonica	767	98.60%	1.30%	0.00%	0.00%	G: 0.13%
Tropical Japonica	504	79.20%	20.00%	0.79%	0.00%	NA
Japonica Intermediate	241	94.60%	4.60%	0.41%	0.00%	G: 0.41%
VI/Aromatic	96	96.90%	0.00%	0.00%	0.00%	G: 3.12%
Intermediate	90	90.00%	6.70%	0.00%	0.00%	G: 3.33%

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122937279	C -> T	LOC_Os11g38660.1	downstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:70.324; most accessible tissue: Callus, score: 90.317	N	N	N	N
vg1122937279	C -> T	LOC_Os11g38650-LOC_Os11g38660	intergenic_region ; MODIFIER	silent_mutation	Average:70.324; most accessible tissue: Callus, score: 90.317	N	N	N	N
vg1122937279	C -> G	LOC_Os11g38660.1	downstream_gene_variant ; 4301.0bp to feature; MODIFIER	silent_mutation	Average:70.324; most accessible tissue: Callus, score: 90.317	N	N	N	N
vg1122937279	C -> G	LOC_Os11g38650-LOC_Os11g38660	intergenic_region ; MODIFIER	silent_mutation	Average:70.324; most accessible tissue: Callus, score: 90.317	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122937279	NA	1.43E-07	mr1422	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	1.46E-09	mr1583	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	1.01E-06	mr1970	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	3.70E-08	mr1973	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	7.61E-06	mr1124_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	2.47E-06	mr1218_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	2.88E-06	1.68E-09	mr1422_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	5.11E-07	1.45E-09	mr1583_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	3.93E-09	NA	mr1850_2	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	1.33E-12	5.86E-17	mr1850_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	3.78E-07	mr1970_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122937279	NA	2.73E-09	mr1973_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251