\
| Variant ID: vg1122935128 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22935128 |
| Reference Allele: G | Alternative Allele: T |
| Primary Allele: G | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
TTATGATTGGTTAAGGAGTGGAGGTAGATGAGAAAATTGAATGGTAGAGGATTGTGATTGGTTGAGAAGAGAATGTTGGTGAAGAAGTTATTATATTTTA[G/T]
GATGGAGGGAGCAGCAGACATTGTGATTATTTTTCGAAACCTCAAATCTTTACGTAGAACGAGGGATAGAAAGGTGGTACTATCAGATTTCTCCTGCGAA
TTCGCAGGAGAAATCTGATAGTACCACCTTTCTATCCCTCGTTCTACGTAAAGATTTGAGGTTTCGAAAAATAATCACAATGTCTGCTGCTCCCTCCATC[C/A]
TAAAATATAATAACTTCTTCACCAACATTCTCTTCTCAACCAATCACAATCCTCTACCATTCAATTTTCTCATCTACCTCCACTCCTTAACCAATCATAA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| All Indica | 2759 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 83.30% | 16.70% | 0.00% | 0.00% | NA |
| Aus | 269 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica I | 595 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Indica II | 465 | 98.30% | 1.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 94.70% | 5.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 97.10% | 2.90% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 90.00% | 10.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 71.80% | 28.20% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 95.60% | 4.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122935128 | G -> T | LOC_Os11g38650-LOC_Os11g38660 | intergenic_region ; MODIFIER | silent_mutation | Average:66.147; most accessible tissue: Minghui63 root, score: 89.247 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122935128 | NA | 8.69E-06 | mr1379_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | 2.17E-07 | NA | mr1403_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 1.64E-06 | mr1422_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 9.27E-06 | mr1559_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 7.27E-06 | mr1575_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 1.64E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 2.18E-07 | mr1606_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | 7.96E-06 | 7.96E-06 | mr1649_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | 1.11E-07 | 1.17E-21 | mr1676_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 1.72E-07 | mr1676_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | 6.46E-06 | 1.23E-06 | mr1849_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 4.62E-06 | mr1849_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | 9.52E-06 | NA | mr1916_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122935128 | NA | 3.89E-06 | mr1980_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |