\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122895639:

Variant ID: vg1122895639 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22895639
Reference Allele: GAlternative Allele: A
Primary Allele: GSecondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.01, others allele: 0.00, population size: 113. )

Flanking Sequence (100 bp) in Reference Genome:


TGCTTCTAAAATTACTCGTGCTCGCCAATTTGGCTACTCATAACGTACATAAAGGAGTCGTCGTTTCGCTTATTCGCGAAATAGGTGAAACGGCATATTT[G/A]
CAAACAAAAAGTGATTTGTAAGTAAAATTTTTATATATGTGTTCTTAGTGATCTAAAAGCAAAGGCTAAAAATAAACTTTGATGAAAAAACCTTAGAATT

Reverse complement sequence

AATTCTAAGGTTTTTTCATCAAAGTTTATTTTTAGCCTTTGCTTTTAGATCACTAAGAACACATATATAAAAATTTTACTTACAAATCACTTTTTGTTTG[C/T]
AAATATGCCGTTTCACCTATTTCGCGAATAAGCGAAACGACGACTCCTTTATGTACGTTATGAGTAGCCAAATTGGCGAGCACGAGTAATTTTAGAAGCA

Allele Frequencies:

Populations Population SizeFrequency of G(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 73.00% 26.90% 0.06% 0.00% NA
All Indica  2759 65.50% 34.40% 0.11% 0.00% NA
All Japonica  1512 80.30% 19.70% 0.00% 0.00% NA
Aus  269 99.60% 0.40% 0.00% 0.00% NA
Indica I  595 26.10% 73.90% 0.00% 0.00% NA
Indica II  465 96.80% 3.20% 0.00% 0.00% NA
Indica III  913 69.90% 30.00% 0.11% 0.00% NA
Indica Intermediate  786 71.80% 28.00% 0.25% 0.00% NA
Temperate Japonica  767 66.20% 33.80% 0.00% 0.00% NA
Tropical Japonica  504 95.60% 4.40% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 86.50% 13.50% 0.00% 0.00% NA
Intermediate  90 86.70% 13.30% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122895639 G -> A LOC_Os11g38620.1 downstream_gene_variant ; 4198.0bp to feature; MODIFIER silent_mutation Average:28.121; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1122895639 G -> A LOC_Os11g38620.2 downstream_gene_variant ; 3604.0bp to feature; MODIFIER silent_mutation Average:28.121; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N
vg1122895639 G -> A LOC_Os11g38620-LOC_Os11g38630 intergenic_region ; MODIFIER silent_mutation Average:28.121; most accessible tissue: Zhenshan97 root, score: 38.035 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122895639 NA 5.28E-06 mr1170 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122895639 NA 8.87E-06 mr1169_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122895639 NA 1.93E-07 mr1842_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122895639 NA 1.31E-08 mr1923_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122895639 NA 3.73E-07 mr1923_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122895639 NA 5.25E-08 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251