\
| Variant ID: vg1122886718 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22886718 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.84, A: 0.16, others allele: 0.00, population size: 104. )
TCCCTAATAAGCCAAAACTTTTTATTAGGAAATAAAATTTATAATTTATAAGTAAAAATTTTATATACATGTTTTAGCAACTTAAAAACTAGGGTAATTT[A/G]
GAACCATGCCATTATAATTTTGCAAAGTTTGAGATATGCCATCGGTATCTCAATGACATGCAAGATCTACATGAGTCAATGACATGTGGGTTAGGATGGC
GCCATCCTAACCCACATGTCATTGACTCATGTAGATCTTGCATGTCATTGAGATACCGATGGCATATCTCAAACTTTGCAAAATTATAATGGCATGGTTC[T/C]
AAATTACCCTAGTTTTTAAGTTGCTAAAACATGTATATAAAATTTTTACTTATAAATTATAAATTTTATTTCCTAATAAAAAGTTTTGGCTTATTAGGGA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.40% | 15.00% | 3.36% | 24.21% | NA |
| All Indica | 2759 | 68.60% | 5.00% | 1.59% | 24.76% | NA |
| All Japonica | 1512 | 35.60% | 28.10% | 6.55% | 29.76% | NA |
| Aus | 269 | 50.20% | 46.10% | 3.72% | 0.00% | NA |
| Indica I | 595 | 29.40% | 5.20% | 2.02% | 63.36% | NA |
| Indica II | 465 | 94.20% | 2.80% | 0.86% | 2.15% | NA |
| Indica III | 913 | 78.30% | 6.10% | 1.42% | 14.13% | NA |
| Indica Intermediate | 786 | 72.00% | 4.80% | 1.91% | 21.25% | NA |
| Temperate Japonica | 767 | 21.90% | 37.30% | 4.43% | 36.38% | NA |
| Tropical Japonica | 504 | 41.30% | 17.50% | 11.90% | 29.37% | NA |
| Japonica Intermediate | 241 | 67.20% | 21.20% | 2.07% | 9.54% | NA |
| VI/Aromatic | 96 | 87.50% | 6.20% | 0.00% | 6.25% | NA |
| Intermediate | 90 | 71.10% | 16.70% | 6.67% | 5.56% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122886718 | A -> DEL | N | N | silent_mutation | Average:42.323; most accessible tissue: Callus, score: 87.349 | N | N | N | N |
| vg1122886718 | A -> G | LOC_Os11g38620.1 | upstream_gene_variant ; 684.0bp to feature; MODIFIER | silent_mutation | Average:42.323; most accessible tissue: Callus, score: 87.349 | N | N | N | N |
| vg1122886718 | A -> G | LOC_Os11g38620.2 | upstream_gene_variant ; 684.0bp to feature; MODIFIER | silent_mutation | Average:42.323; most accessible tissue: Callus, score: 87.349 | N | N | N | N |
| vg1122886718 | A -> G | LOC_Os11g38610.2 | downstream_gene_variant ; 2171.0bp to feature; MODIFIER | silent_mutation | Average:42.323; most accessible tissue: Callus, score: 87.349 | N | N | N | N |
| vg1122886718 | A -> G | LOC_Os11g38610-LOC_Os11g38620 | intergenic_region ; MODIFIER | silent_mutation | Average:42.323; most accessible tissue: Callus, score: 87.349 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122886718 | NA | 2.20E-06 | mr1236_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122886718 | 4.89E-06 | 2.68E-06 | mr1462_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122886718 | NA | 2.77E-06 | mr1704_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122886718 | 5.70E-06 | 5.70E-06 | mr1867_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |