\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122861852:

Variant ID: vg1122861852 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22861852
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 0.64, G: 0.36, others allele: 0.00, population size: 66. )

Flanking Sequence (100 bp) in Reference Genome:


TAAAATTAATATGATGTATTAGGGCAAGTGTGCTAGAGGTGATTTGTTCTATATATTGACTCTTAATTAATGAGTTGATGATGTTGACTAAATTAAGGTG[A/G]
CTATCACCTCCACTATAAAACTTGTCCTGAGAAAGCGACCGCACCGTATGAACGGGCCCTGACTGCCATAACTCAGTCCATTGTCTTAAGTCGCAAATTA

Reverse complement sequence

TAATTTGCGACTTAAGACAATGGACTGAGTTATGGCAGTCAGGGCCCGTTCATACGGTGCGGTCGCTTTCTCAGGACAAGTTTTATAGTGGAGGTGATAG[T/C]
CACCTTAATTTAGTCAACATCATCAACTCATTAATTAAGAGTCAATATATAGAACAAATCACCTCTAGCACACTTGCCCTAATACATCATATTAATTTTA

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 43.30% 31.30% 0.51% 24.88% NA
All Indica  2759 34.30% 46.80% 0.51% 18.34% NA
All Japonica  1512 65.30% 7.40% 0.26% 27.05% NA
Aus  269 4.50% 10.40% 0.74% 84.39% NA
Indica I  595 71.40% 11.30% 0.17% 17.14% NA
Indica II  465 6.20% 91.40% 0.22% 2.15% NA
Indica III  913 29.40% 40.10% 0.99% 29.57% NA
Indica Intermediate  786 28.60% 55.20% 0.38% 15.78% NA
Temperate Japonica  767 79.10% 4.80% 0.26% 15.78% NA
Tropical Japonica  504 56.50% 11.70% 0.40% 31.35% NA
Japonica Intermediate  241 39.40% 6.60% 0.00% 53.94% NA
VI/Aromatic  96 76.00% 1.00% 4.17% 18.75% NA
Intermediate  90 30.00% 52.20% 0.00% 17.78% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122861852 A -> DEL N N silent_mutation Average:74.546; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N
vg1122861852 A -> G LOC_Os11g38580.1 upstream_gene_variant ; 595.0bp to feature; MODIFIER silent_mutation Average:74.546; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N
vg1122861852 A -> G LOC_Os11g38560-LOC_Os11g38580 intergenic_region ; MODIFIER silent_mutation Average:74.546; most accessible tissue: Minghui63 flag leaf, score: 89.905 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122861852 NA 4.34E-06 mr1030 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 4.94E-06 mr1074 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 5.55E-06 mr1148 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 6.67E-06 6.20E-09 mr1268 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 5.75E-07 mr1268 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 2.56E-06 mr1337 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 2.40E-06 mr1928 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 3.85E-06 mr1942 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 8.38E-06 mr1974 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 1.35E-12 mr1565_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 1.24E-10 mr1715_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 7.09E-07 mr1933_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122861852 NA 1.66E-06 mr1942_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251