Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122770823:

Variant ID: vg1122770823 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22770823
Reference Allele: C	Alternative Allele: A
Primary Allele: C	Secondary Allele: A

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

TACTCTTAACACATTAATTAAGGGTGGTAAACTACTTAACCACTGAAGACATCATGATTGCTAGTTTACTACAAAAGGGCAGCGCCTAATGTAGCAATTT[C/A]
CAATCCCAATTCACATAACTTAAATGCAACCACATTATAGAGTTAATCTCGGATAGCAAACTCTACTGATTATTCAAAGCTATGAAGGATCATTCTAAAG

Reverse complement sequence

CTTTAGAATGATCCTTCATAGCTTTGAATAATCAGTAGAGTTTGCTATCCGAGATTAACTCTATAATGTGGTTGCATTTAAGTTATGTGAATTGGGATTG[G/T]
AAATTGCTACATTAGGCGCTGCCCTTTTGTAGTAAACTAGCAATCATGATGTCTTCAGTGGTTAAGTAGTTTACCACCCTTAATTAATGTGTTAAGAGTA

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	87.50%	8.70%	0.91%	2.96%	NA
All Indica	2759	94.70%	2.60%	0.14%	2.50%	NA
All Japonica	1512	79.60%	13.50%	2.31%	4.56%	NA
Aus	269	56.10%	42.80%	1.12%	0.00%	NA
Indica I	595	99.70%	0.30%	0.00%	0.00%	NA
Indica II	465	96.60%	3.20%	0.22%	0.00%	NA
Indica III	913	91.10%	2.70%	0.11%	6.02%	NA
Indica Intermediate	786	94.10%	3.80%	0.25%	1.78%	NA
Temperate Japonica	767	84.20%	13.70%	0.65%	1.43%	NA
Tropical Japonica	504	80.00%	12.30%	3.37%	4.37%	NA
Japonica Intermediate	241	64.30%	15.40%	5.39%	14.94%	NA
VI/Aromatic	96	89.60%	9.40%	0.00%	1.04%	NA
Intermediate	90	87.80%	10.00%	1.11%	1.11%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122770823	C -> A	LOC_Os11g38440.1	downstream_gene_variant ; 3143.0bp to feature; MODIFIER	silent_mutation	Average:46.046; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg1122770823	C -> A	LOC_Os11g38450.1	intron_variant ; MODIFIER	silent_mutation	Average:46.046; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N
vg1122770823	C -> DEL	N	N	silent_mutation	Average:46.046; most accessible tissue: Minghui63 flag leaf, score: 78.154	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122770823	NA	5.85E-06	mr1045	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	2.53E-06	mr1310	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	7.59E-06	mr1679	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	2.86E-09	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	2.04E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	8.23E-09	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	8.12E-06	mr1324_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	1.93E-07	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	8.25E-08	mr1326_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	6.47E-06	mr1333_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	6.92E-08	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	3.21E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	7.80E-07	mr1449_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	8.19E-08	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	3.13E-06	mr1623_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	2.08E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	1.69E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122770823	NA	9.08E-06	mr1908_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251