\
| Variant ID: vg1122736186 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22736186 |
| Reference Allele: A | Alternative Allele: G |
| Primary Allele: A | Secondary Allele: G |
Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )
CCCGTCTTACGTGGATGGAGAAGCTCCCAACCGTTGTTGTCGAACGCAGCCTAAGATGATTTGGCTGCTTAATTATCATATTGACATTTATATTTTTCTC[A/G]
TATATAACAGCTCCTCTAGGACCGATGGATCATTGGAATAATTGCAGAAATAAGGGTGACGGATGCAAGGAGGAACCATATGCGATGCTGCAAATATTTG
CAAATATTTGCAGCATCGCATATGGTTCCTCCTTGCATCCGTCACCCTTATTTCTGCAATTATTCCAATGATCCATCGGTCCTAGAGGAGCTGTTATATA[T/C]
GAGAAAAATATAAATGTCAATATGATAATTAAGCAGCCAAATCATCTTAGGCTGCGTTCGACAACAACGGTTGGGAGCTTCTCCATCCACGTAAGACGGG
| Populations | Population Size | Frequency of A(primary allele) | Frequency of G(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 57.90% | 41.90% | 0.17% | 0.00% | NA |
| All Indica | 2759 | 35.30% | 64.60% | 0.18% | 0.00% | NA |
| All Japonica | 1512 | 92.40% | 7.50% | 0.07% | 0.00% | NA |
| Aus | 269 | 85.10% | 14.10% | 0.74% | 0.00% | NA |
| Indica I | 595 | 15.00% | 84.20% | 0.84% | 0.00% | NA |
| Indica II | 465 | 37.00% | 63.00% | 0.00% | 0.00% | NA |
| Indica III | 913 | 52.00% | 48.00% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 30.20% | 69.80% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 95.20% | 4.70% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 92.90% | 7.10% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 92.70% | 7.30% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 55.60% | 44.40% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122736186 | A -> G | LOC_Os11g38380.1 | downstream_gene_variant ; 3264.0bp to feature; MODIFIER | silent_mutation | Average:52.052; most accessible tissue: Callus, score: 80.459 | N | N | N | N |
| vg1122736186 | A -> G | LOC_Os11g38400.1 | downstream_gene_variant ; 2551.0bp to feature; MODIFIER | silent_mutation | Average:52.052; most accessible tissue: Callus, score: 80.459 | N | N | N | N |
| vg1122736186 | A -> G | LOC_Os11g38390.1 | intron_variant ; MODIFIER | silent_mutation | Average:52.052; most accessible tissue: Callus, score: 80.459 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122736186 | NA | 2.34E-06 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 1.88E-19 | mr1422 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 2.59E-15 | mr1583 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 2.06E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 9.98E-06 | mr1691 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 8.84E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 9.59E-08 | mr1728 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 5.28E-07 | mr1850 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | 1.19E-06 | 1.19E-06 | mr1850 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 1.70E-08 | mr1860 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 1.74E-06 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 7.10E-09 | mr1220_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 2.29E-11 | mr1228_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | 3.07E-06 | 3.07E-06 | mr1333_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 6.58E-14 | mr1583_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 2.12E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 3.28E-12 | mr1728_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 1.77E-12 | mr1850_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122736186 | NA | 5.41E-08 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |