\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122736186:

Variant ID: vg1122736186 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22736186
Reference Allele: AAlternative Allele: G
Primary Allele: ASecondary Allele: G

Inferred Ancestral Allele : A (evidence from allele frequency in Oryza rufipogon: A: 1.00, G: 0.01, others allele: 0.00, population size: 109. )

Flanking Sequence (100 bp) in Reference Genome:


CCCGTCTTACGTGGATGGAGAAGCTCCCAACCGTTGTTGTCGAACGCAGCCTAAGATGATTTGGCTGCTTAATTATCATATTGACATTTATATTTTTCTC[A/G]
TATATAACAGCTCCTCTAGGACCGATGGATCATTGGAATAATTGCAGAAATAAGGGTGACGGATGCAAGGAGGAACCATATGCGATGCTGCAAATATTTG

Reverse complement sequence

CAAATATTTGCAGCATCGCATATGGTTCCTCCTTGCATCCGTCACCCTTATTTCTGCAATTATTCCAATGATCCATCGGTCCTAGAGGAGCTGTTATATA[T/C]
GAGAAAAATATAAATGTCAATATGATAATTAAGCAGCCAAATCATCTTAGGCTGCGTTCGACAACAACGGTTGGGAGCTTCTCCATCCACGTAAGACGGG

Allele Frequencies:

Populations Population SizeFrequency of A(primary allele) Frequency of G(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 57.90% 41.90% 0.17% 0.00% NA
All Indica  2759 35.30% 64.60% 0.18% 0.00% NA
All Japonica  1512 92.40% 7.50% 0.07% 0.00% NA
Aus  269 85.10% 14.10% 0.74% 0.00% NA
Indica I  595 15.00% 84.20% 0.84% 0.00% NA
Indica II  465 37.00% 63.00% 0.00% 0.00% NA
Indica III  913 52.00% 48.00% 0.00% 0.00% NA
Indica Intermediate  786 30.20% 69.80% 0.00% 0.00% NA
Temperate Japonica  767 95.20% 4.70% 0.13% 0.00% NA
Tropical Japonica  504 87.90% 12.10% 0.00% 0.00% NA
Japonica Intermediate  241 92.90% 7.10% 0.00% 0.00% NA
VI/Aromatic  96 92.70% 7.30% 0.00% 0.00% NA
Intermediate  90 55.60% 44.40% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122736186 A -> G LOC_Os11g38380.1 downstream_gene_variant ; 3264.0bp to feature; MODIFIER silent_mutation Average:52.052; most accessible tissue: Callus, score: 80.459 N N N N
vg1122736186 A -> G LOC_Os11g38400.1 downstream_gene_variant ; 2551.0bp to feature; MODIFIER silent_mutation Average:52.052; most accessible tissue: Callus, score: 80.459 N N N N
vg1122736186 A -> G LOC_Os11g38390.1 intron_variant ; MODIFIER silent_mutation Average:52.052; most accessible tissue: Callus, score: 80.459 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122736186 NA 2.34E-06 mr1188 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 1.88E-19 mr1422 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 2.59E-15 mr1583 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 2.06E-07 mr1583 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 9.98E-06 mr1691 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 8.84E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 9.59E-08 mr1728 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 5.28E-07 mr1850 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 1.19E-06 1.19E-06 mr1850 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 1.70E-08 mr1860 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 1.74E-06 mr1188_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 7.10E-09 mr1220_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 2.29E-11 mr1228_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 3.07E-06 3.07E-06 mr1333_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 6.58E-14 mr1583_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 2.12E-06 mr1686_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 3.28E-12 mr1728_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 1.77E-12 mr1850_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122736186 NA 5.41E-08 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251