\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122689875:

Variant ID: vg1122689875 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22689875
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 70. )

Flanking Sequence (100 bp) in Reference Genome:


CCCATCCAACCAAAACTCTTATATTCTAAGACTGAGAGGATATTATAGTTTTCAGGATATAGATAATAATACCGATATCCAATTAACAATGCTATTCGGA[T/C]
ATCGCTTAAGACATAAAACATAGTACTAACTCTTTATATTTATATATTTTAATAGTAACTCATCTCACAGCACTAGTCCAGATTGTTAATATTATTTAAA

Reverse complement sequence

TTTAAATAATATTAACAATCTGGACTAGTGCTGTGAGATGAGTTACTATTAAAATATATAAATATAAAGAGTTAGTACTATGTTTTATGTCTTAAGCGAT[A/G]
TCCGAATAGCATTGTTAATTGGATATCGGTATTATTATCTATATCCTGAAAACTATAATATCCTCTCAGTCTTAGAATATAAGAGTTTTGGTTGGATGGG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 81.20% 18.80% 0.04% 0.00% NA
All Indica  2759 89.20% 10.80% 0.04% 0.00% NA
All Japonica  1512 68.00% 31.90% 0.07% 0.00% NA
Aus  269 96.30% 3.70% 0.00% 0.00% NA
Indica I  595 99.30% 0.70% 0.00% 0.00% NA
Indica II  465 68.20% 31.60% 0.22% 0.00% NA
Indica III  913 95.70% 4.30% 0.00% 0.00% NA
Indica Intermediate  786 86.30% 13.70% 0.00% 0.00% NA
Temperate Japonica  767 65.80% 34.00% 0.13% 0.00% NA
Tropical Japonica  504 79.60% 20.40% 0.00% 0.00% NA
Japonica Intermediate  241 50.60% 49.40% 0.00% 0.00% NA
VI/Aromatic  96 26.00% 74.00% 0.00% 0.00% NA
Intermediate  90 71.10% 28.90% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122689875 T -> C LOC_Os11g38320.1 downstream_gene_variant ; 4751.0bp to feature; MODIFIER silent_mutation Average:24.97; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N
vg1122689875 T -> C LOC_Os11g38310-LOC_Os11g38320 intergenic_region ; MODIFIER silent_mutation Average:24.97; most accessible tissue: Zhenshan97 panicle, score: 43.098 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122689875 NA 6.47E-06 mr1122 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 1.73E-06 mr1310 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 8.59E-06 mr1693 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 6.70E-06 mr1720 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 1.24E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 6.69E-10 mr1889 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 3.40E-09 mr1903 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 7.00E-10 mr1934 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 2.85E-06 2.85E-06 mr1273_2 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 1.26E-06 mr1310_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122689875 NA 2.88E-06 mr1336_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251