\
| Variant ID: vg1122689875 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22689875 |
| Reference Allele: T | Alternative Allele: C |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.94, C: 0.06, others allele: 0.00, population size: 70. )
CCCATCCAACCAAAACTCTTATATTCTAAGACTGAGAGGATATTATAGTTTTCAGGATATAGATAATAATACCGATATCCAATTAACAATGCTATTCGGA[T/C]
ATCGCTTAAGACATAAAACATAGTACTAACTCTTTATATTTATATATTTTAATAGTAACTCATCTCACAGCACTAGTCCAGATTGTTAATATTATTTAAA
TTTAAATAATATTAACAATCTGGACTAGTGCTGTGAGATGAGTTACTATTAAAATATATAAATATAAAGAGTTAGTACTATGTTTTATGTCTTAAGCGAT[A/G]
TCCGAATAGCATTGTTAATTGGATATCGGTATTATTATCTATATCCTGAAAACTATAATATCCTCTCAGTCTTAGAATATAAGAGTTTTGGTTGGATGGG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 81.20% | 18.80% | 0.04% | 0.00% | NA |
| All Indica | 2759 | 89.20% | 10.80% | 0.04% | 0.00% | NA |
| All Japonica | 1512 | 68.00% | 31.90% | 0.07% | 0.00% | NA |
| Aus | 269 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.30% | 0.70% | 0.00% | 0.00% | NA |
| Indica II | 465 | 68.20% | 31.60% | 0.22% | 0.00% | NA |
| Indica III | 913 | 95.70% | 4.30% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 86.30% | 13.70% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 65.80% | 34.00% | 0.13% | 0.00% | NA |
| Tropical Japonica | 504 | 79.60% | 20.40% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 50.60% | 49.40% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 26.00% | 74.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 71.10% | 28.90% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122689875 | T -> C | LOC_Os11g38320.1 | downstream_gene_variant ; 4751.0bp to feature; MODIFIER | silent_mutation | Average:24.97; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| vg1122689875 | T -> C | LOC_Os11g38310-LOC_Os11g38320 | intergenic_region ; MODIFIER | silent_mutation | Average:24.97; most accessible tissue: Zhenshan97 panicle, score: 43.098 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122689875 | NA | 6.47E-06 | mr1122 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 1.73E-06 | mr1310 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 8.59E-06 | mr1693 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 6.70E-06 | mr1720 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 1.24E-06 | mr1835 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 6.69E-10 | mr1889 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 3.40E-09 | mr1903 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 7.00E-10 | mr1934 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | 2.85E-06 | 2.85E-06 | mr1273_2 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 1.26E-06 | mr1310_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122689875 | NA | 2.88E-06 | mr1336_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |