Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122688601:

Variant ID: vg1122688601 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22688601
Reference Allele: G	Alternative Allele: A
Primary Allele: G	Secondary Allele: A

Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 0.97, A: 0.03, others allele: 0.00, population size: 59. )

Flanking Sequence (100 bp) in Reference Genome:

ACTTTTTTTTTTTTCGTGAAACAGTAGCATAAAAATAGGATCAGAAAAAGAAAGGAAACCGGGGATCGATGGAAGGGGAGGTTCACGGAAAAATTTAATC[G/A]
GATGGTCTAAAATATCGGGTCCACCAATTTAAGTGAAAATCGACGGTTAGATTTGACAGAGCCACGTGGCGGTTTAGGAGCATTTGTAGGAGTCCTACGT

Reverse complement sequence

ACGTAGGACTCCTACAAATGCTCCTAAACCGCCACGTGGCTCTGTCAAATCTAACCGTCGATTTTCACTTAAATTGGTGGACCCGATATTTTAGACCATC[C/T]
GATTAAATTTTTCCGTGAACCTCCCCTTCCATCGATCCCCGGTTTCCTTTCTTTTTCTGATCCTATTTTTATGCTACTGTTTCACGAAAAAAAAAAAAGT

Allele Frequencies:

Populations	Population Size	Frequency of G(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	29.70%	2.60%	14.05%	53.68%	NA
All Indica	2759	4.70%	4.00%	21.20%	70.10%	NA
All Japonica	1512	80.20%	0.30%	1.85%	17.72%	NA
Aus	269	9.30%	2.20%	15.61%	72.86%	NA
Indica I	595	0.50%	4.50%	33.11%	61.85%	NA
Indica II	465	4.10%	0.20%	4.73%	90.97%	NA
Indica III	913	6.90%	6.80%	21.69%	64.62%	NA
Indica Intermediate	786	5.70%	2.50%	21.37%	70.36%	NA
Temperate Japonica	767	75.60%	0.50%	2.61%	21.25%	NA
Tropical Japonica	504	89.10%	0.00%	0.79%	10.12%	NA
Japonica Intermediate	241	75.90%	0.00%	1.66%	22.41%	NA
VI/Aromatic	96	6.20%	0.00%	4.17%	89.58%	NA
Intermediate	90	34.40%	1.10%	5.56%	58.89%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122688601	G -> A	LOC_Os11g38310.1	upstream_gene_variant ; 4009.0bp to feature; MODIFIER	silent_mutation	Average:16.39; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1122688601	G -> A	LOC_Os11g38310-LOC_Os11g38320	intergenic_region ; MODIFIER	silent_mutation	Average:16.39; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N
vg1122688601	G -> DEL	N	N	silent_mutation	Average:16.39; most accessible tissue: Minghui63 panicle, score: 29.741	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122688601	NA	2.40E-09	mr1050	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.04E-07	mr1066	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	7.22E-06	mr1209	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.39E-07	mr1220	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.08E-10	mr1307	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.81E-06	mr1315	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.29E-06	mr1420	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	4.99E-06	mr1461	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	6.78E-08	mr1488	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	8.27E-08	mr1506	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.01E-06	mr1507	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.72E-06	mr1508	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.16E-08	mr1668	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.31E-06	mr1677	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.03E-11	mr1775	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.24E-07	mr1797	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.24E-07	mr1801	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	8.91E-08	mr1810	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.02E-06	mr1812	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.01E-07	mr1835	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.54E-07	mr1886	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.10E-10	mr1889	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.85E-11	mr1904	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	4.06E-09	mr1934	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.02E-09	mr1986	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.77E-06	mr1992	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.73E-09	mr1050_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.13E-06	mr1188_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	7.89E-07	mr1227_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.58E-07	mr1272_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.03E-06	mr1310_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.38E-08	mr1321_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.19E-07	mr1322_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.58E-07	mr1324_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.15E-07	mr1325_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.63E-07	mr1326_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.18E-06	mr1332_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	7.79E-06	mr1333_2	Ind_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.28E-07	mr1336_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	6.12E-06	mr1338_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	1.15E-06	mr1540_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	3.27E-08	mr1607_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	8.07E-07	mr1732_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122688601	NA	2.60E-06	mr1875_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251