\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122664014:

Variant ID: vg1122664014 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22664014
Reference Allele: TAlternative Allele: C
Primary Allele: TSecondary Allele: C

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


AAACCATTAACTCTATCTCACAATTTAGCGAGTATCACGGCAACCGTATGATTATCGCGAGATATAATATGGTTTCTAAAACTAAAATAACCGTGATAAT[T/C]
GGTTTTGTACACCCTCCACCAGAGCTCGACCAAAACAATGCGGCGCTGGCAAGCTGCACATGCCTTTCTAGCTTGCAGCCAAGATGTACGGAAGCAAAGC

Reverse complement sequence

GCTTTGCTTCCGTACATCTTGGCTGCAAGCTAGAAAGGCATGTGCAGCTTGCCAGCGCCGCATTGTTTTGGTCGAGCTCTGGTGGAGGGTGTACAAAACC[A/G]
ATTATCACGGTTATTTTAGTTTTAGAAACCATATTATATCTCGCGATAATCATACGGTTGCCGTGATACTCGCTAAATTGTGAGATAGAGTTAATGGTTT

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of C(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 75.40% 20.80% 3.09% 0.72% NA
All Indica  2759 98.80% 1.10% 0.04% 0.04% NA
All Japonica  1512 31.90% 56.50% 9.46% 2.18% NA
Aus  269 93.30% 6.70% 0.00% 0.00% NA
Indica I  595 99.80% 0.00% 0.17% 0.00% NA
Indica II  465 99.60% 0.20% 0.00% 0.22% NA
Indica III  913 98.90% 1.10% 0.00% 0.00% NA
Indica Intermediate  786 97.60% 2.40% 0.00% 0.00% NA
Temperate Japonica  767 38.60% 52.00% 8.21% 1.17% NA
Tropical Japonica  504 21.60% 66.10% 8.93% 3.37% NA
Japonica Intermediate  241 32.00% 50.60% 14.52% 2.90% NA
VI/Aromatic  96 33.30% 66.70% 0.00% 0.00% NA
Intermediate  90 77.80% 20.00% 2.22% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122664014 T -> DEL N N silent_mutation Average:89.751; most accessible tissue: Minghui63 panicle, score: 95.81 N N N N
vg1122664014 T -> C LOC_Os11g38250.1 upstream_gene_variant ; 3799.0bp to feature; MODIFIER silent_mutation Average:89.751; most accessible tissue: Minghui63 panicle, score: 95.81 N N N N
vg1122664014 T -> C LOC_Os11g38260.1 downstream_gene_variant ; 1672.0bp to feature; MODIFIER silent_mutation Average:89.751; most accessible tissue: Minghui63 panicle, score: 95.81 N N N N
vg1122664014 T -> C LOC_Os11g38280.1 downstream_gene_variant ; 2017.0bp to feature; MODIFIER silent_mutation Average:89.751; most accessible tissue: Minghui63 panicle, score: 95.81 N N N N
vg1122664014 T -> C LOC_Os11g38270.1 intron_variant ; MODIFIER silent_mutation Average:89.751; most accessible tissue: Minghui63 panicle, score: 95.81 N N N N

Effects Predicted by Deep Convolutional Neural Networks

For each variant, we constructed two sequences that contain the variation site and the sequence around it, differing only in the variation site. We then used Basenji to predict the chromatin accessibility of each tissue for the two sequences, respectively, and scored the effect of the variant by comparing the changes in chromatin accessibility corresponding to the two genotypes in the 1 kb region around the variation site. The effect score was defined as the logarithmic ratio of the predicted chromatin accessibility of the alternative genotype to the value of the reference genotype.

Var ID Ref Alt Root (RT) Young Leaf (YL) Flag Leaf (FL) Young Panicle (YP) Lemma & Palea (LP) Stamen & Pistil (SP)
vg1122664014 T C 0.01 0.0 0.0 0.03 0.02 0.02

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122664014 NA 2.80E-09 mr1097 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 NA 3.98E-10 mr1128 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 2.40E-06 NA mr1140 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 3.49E-07 NA mr1203 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 6.66E-06 NA mr1203 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 4.87E-06 NA mr1618 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 NA 8.56E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 NA 3.29E-06 mr1835 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 NA 4.66E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122664014 NA 5.65E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251