| Variant ID: vg1122663480 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22663480 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele : C (evidence from allele frequency in Oryza rufipogon: C: 1.00, others allele: 0.00, population size: 47. )
CAAAAAGTACCGCATTTAATTTGTAAGTACATTACACAAAAGCTTTGTTTAGTAAGGGCCCTTTTGAATCAAAGTATTTATATAAAAATTTCATAGGATT[C/T]
AAATCCTATAGGAAATTTTCCTATTTGTCCATTTGATTTAAATGATTGAAGCTTTCCAAATCCTATGAAATTCCTATAGAATGGCACATTGTATGTGGAT
ATCCACATACAATGTGCCATTCTATAGGAATTTCATAGGATTTGGAAAGCTTCAATCATTTAAATCAAATGGACAAATAGGAAAATTTCCTATAGGATTT[G/A]
AATCCTATGAAATTTTTATATAAATACTTTGATTCAAAAGGGCCCTTACTAAACAAAGCTTTTGTGTAATGTACTTACAAATTAAATGCGGTACTTTTTG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 54.80% | 19.00% | 1.63% | 24.50% | NA |
| All Indica | 2759 | 68.50% | 27.60% | 1.78% | 2.07% | NA |
| All Japonica | 1512 | 26.50% | 5.70% | 0.86% | 67.00% | NA |
| Aus | 269 | 82.50% | 10.80% | 0.00% | 6.69% | NA |
| Indica I | 595 | 90.30% | 7.40% | 1.51% | 0.84% | NA |
| Indica II | 465 | 41.10% | 54.20% | 3.01% | 1.72% | NA |
| Indica III | 913 | 76.80% | 21.10% | 0.44% | 1.64% | NA |
| Indica Intermediate | 786 | 58.80% | 34.70% | 2.80% | 3.69% | NA |
| Temperate Japonica | 767 | 36.20% | 2.50% | 0.52% | 60.76% | NA |
| Tropical Japonica | 504 | 10.70% | 11.50% | 1.19% | 76.59% | NA |
| Japonica Intermediate | 241 | 28.20% | 3.70% | 1.24% | 66.80% | NA |
| VI/Aromatic | 96 | 34.40% | 1.00% | 10.42% | 54.17% | NA |
| Intermediate | 90 | 50.00% | 24.40% | 5.56% | 20.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122663480 | C -> T | LOC_Os11g38270.1 | missense_variant ; p.Glu124Lys; MODERATE | nonsynonymous_codon ; E124K | Average:45.641; most accessible tissue: Minghui63 flag leaf, score: 72.472 | unknown | unknown | TOLERATED | 0.44 |
| vg1122663480 | C -> DEL | LOC_Os11g38270.1 | N | frameshift_variant | Average:45.641; most accessible tissue: Minghui63 flag leaf, score: 72.472 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122663480 | NA | 1.08E-07 | mr1188 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | NA | 2.34E-07 | mr1583 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | NA | 1.48E-08 | mr1188_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | 2.11E-06 | 2.11E-06 | mr1333_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | NA | 5.14E-06 | mr1583_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | NA | 6.32E-06 | mr1686_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122663480 | NA | 1.09E-10 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |