\
| Variant ID: vg1122650141 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22650141 |
| Reference Allele: G | Alternative Allele: A |
| Primary Allele: G | Secondary Allele: A |
Inferred Ancestral Allele : G (evidence from allele frequency in Oryza rufipogon: G: 1.00, A: 0.00, others allele: 0.00, population size: 272. )
TGACGGCATTCGTCGAAAAGGGGAAGCTGAAGAAGATTGCAGGGGTGAAGACCAAAGAGCTGATGCTGTGGCTCAGTGTGGTTGAGGTCTATGTTGATGA[G/A]
TCTTCTGCTGGGAAGATCACATTCAAGACTGGCACTGGCCTCTCCGATAGTTTTGATGCGTCGGCCTTCGAGTTAGGAATGTAAACTGAAGAACATATCA
TGATATGTTCTTCAGTTTACATTCCTAACTCGAAGGCCGACGCATCAAAACTATCGGAGAGGCCAGTGCCAGTCTTGAATGTGATCTTCCCAGCAGAAGA[C/T]
TCATCAACATAGACCTCAACCACACTGAGCCACAGCATCAGCTCTTTGGTCTTCACCCCTGCAATCTTCTTCAGCTTCCCCTTTTCGACGAATGCCGTCA
| Populations | Population Size | Frequency of G(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 77.30% | 22.50% | 0.02% | 0.19% | NA |
| All Indica | 2759 | 99.10% | 0.90% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 31.70% | 67.70% | 0.00% | 0.60% | NA |
| Aus | 269 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica I | 595 | 99.80% | 0.20% | 0.00% | 0.00% | NA |
| Indica II | 465 | 99.60% | 0.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 98.90% | 1.10% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 98.50% | 1.50% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 38.30% | 61.70% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 21.20% | 77.20% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 32.80% | 66.80% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 100.00% | 0.00% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 84.40% | 14.40% | 1.11% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122650141 | G -> A | LOC_Os11g38210.1 | synonymous_variant ; p.Glu115Glu; LOW | synonymous_codon | Average:54.749; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| vg1122650141 | G -> DEL | LOC_Os11g38210.1 | N | frameshift_variant | Average:54.749; most accessible tissue: Zhenshan97 flower, score: 68.001 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122650141 | NA | 2.75E-06 | mr1028 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 2.73E-06 | NA | mr1071 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 1.35E-07 | NA | mr1140 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 5.31E-07 | NA | mr1203 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 1.38E-28 | mr1238 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 8.65E-06 | 1.43E-30 | mr1309 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 2.26E-06 | NA | mr1395 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 1.11E-18 | mr1484 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 3.87E-07 | NA | mr1618 | All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 6.26E-13 | mr1641 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 1.60E-14 | mr1900 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 2.32E-10 | mr1921 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 1.42E-06 | 1.23E-31 | mr1238_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 7.22E-07 | 1.60E-29 | mr1484_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 1.90E-06 | 2.14E-33 | mr1841_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | 9.88E-06 | 3.35E-23 | mr1900_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122650141 | NA | 1.89E-19 | mr1945_2 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |