\
| Variant ID: vg1122649502 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22649502 |
| Reference Allele: T | Alternative Allele: A |
| Primary Allele: T | Secondary Allele: A |
Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 218. )
CATAGATTCGCATATGCTTCCTTGACATCTCCACAGAAACAAGGCTACAATAGCACAATGGTGATATTGCCAGAGATGACCAGATTGACCTTGTAGTGCT[T/A]
TGCCTGAAGAGCAGTGAGACAGAGTGACTTGGTCCAAGATGTTAGGCTCTGTACCCCAGGACAGAACCAAGTCAAGAAAAAATTATCACAACAAATTTTT
AAAAATTTGTTGTGATAATTTTTTCTTGACTTGGTTCTGTCCTGGGGTACAGAGCCTAACATCTTGGACCAAGTCACTCTGTCTCACTGCTCTTCAGGCA[A/T]
AGCACTACAAGGTCAATCTGGTCATCTCTGGCAATATCACCATTGTGCTATTGTAGCCTTGTTTCTGTGGAGATGTCAAGGAAGCATATGCGAATCTATG
| Populations | Population Size | Frequency of T(primary allele) | Frequency of A(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 83.70% | 15.90% | 0.02% | 0.38% | NA |
| All Indica | 2759 | 83.50% | 16.20% | 0.00% | 0.33% | NA |
| All Japonica | 1512 | 93.50% | 5.90% | 0.00% | 0.60% | NA |
| Aus | 269 | 30.50% | 69.10% | 0.37% | 0.00% | NA |
| Indica I | 595 | 95.00% | 4.70% | 0.00% | 0.34% | NA |
| Indica II | 465 | 96.60% | 3.40% | 0.00% | 0.00% | NA |
| Indica III | 913 | 66.60% | 32.70% | 0.00% | 0.66% | NA |
| Indica Intermediate | 786 | 86.80% | 13.10% | 0.00% | 0.13% | NA |
| Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 87.10% | 11.30% | 0.00% | 1.59% | NA |
| Japonica Intermediate | 241 | 95.90% | 3.70% | 0.00% | 0.41% | NA |
| VI/Aromatic | 96 | 85.40% | 14.60% | 0.00% | 0.00% | NA |
| Intermediate | 90 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122649502 | T -> A | LOC_Os11g38200.1 | upstream_gene_variant ; 2289.0bp to feature; MODIFIER | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| vg1122649502 | T -> A | LOC_Os11g38210.1 | upstream_gene_variant ; 283.0bp to feature; MODIFIER | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| vg1122649502 | T -> A | LOC_Os11g38220.1 | upstream_gene_variant ; 1994.0bp to feature; MODIFIER | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| vg1122649502 | T -> A | LOC_Os11g38230.1 | downstream_gene_variant ; 4637.0bp to feature; MODIFIER | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| vg1122649502 | T -> A | LOC_Os11g38200-LOC_Os11g38210 | intergenic_region ; MODIFIER | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| vg1122649502 | T -> DEL | N | N | silent_mutation | Average:62.545; most accessible tissue: Callus, score: 91.586 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122649502 | NA | 1.82E-06 | mr1705 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122649502 | NA | 5.21E-07 | mr1800 | All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122649502 | NA | 1.12E-06 | mr1180_2 | Ind_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122649502 | 1.87E-07 | 6.94E-06 | mr1748_2 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122649502 | NA | 5.27E-09 | mr1850_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |