\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122649502:

Variant ID: vg1122649502 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22649502
Reference Allele: TAlternative Allele: A
Primary Allele: TSecondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:


CATAGATTCGCATATGCTTCCTTGACATCTCCACAGAAACAAGGCTACAATAGCACAATGGTGATATTGCCAGAGATGACCAGATTGACCTTGTAGTGCT[T/A]
TGCCTGAAGAGCAGTGAGACAGAGTGACTTGGTCCAAGATGTTAGGCTCTGTACCCCAGGACAGAACCAAGTCAAGAAAAAATTATCACAACAAATTTTT

Reverse complement sequence

AAAAATTTGTTGTGATAATTTTTTCTTGACTTGGTTCTGTCCTGGGGTACAGAGCCTAACATCTTGGACCAAGTCACTCTGTCTCACTGCTCTTCAGGCA[A/T]
AGCACTACAAGGTCAATCTGGTCATCTCTGGCAATATCACCATTGTGCTATTGTAGCCTTGTTTCTGTGGAGATGTCAAGGAAGCATATGCGAATCTATG

Allele Frequencies:

Populations Population SizeFrequency of T(primary allele) Frequency of A(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 83.70% 15.90% 0.02% 0.38% NA
All Indica  2759 83.50% 16.20% 0.00% 0.33% NA
All Japonica  1512 93.50% 5.90% 0.00% 0.60% NA
Aus  269 30.50% 69.10% 0.37% 0.00% NA
Indica I  595 95.00% 4.70% 0.00% 0.34% NA
Indica II  465 96.60% 3.40% 0.00% 0.00% NA
Indica III  913 66.60% 32.70% 0.00% 0.66% NA
Indica Intermediate  786 86.80% 13.10% 0.00% 0.13% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 87.10% 11.30% 0.00% 1.59% NA
Japonica Intermediate  241 95.90% 3.70% 0.00% 0.41% NA
VI/Aromatic  96 85.40% 14.60% 0.00% 0.00% NA
Intermediate  90 82.20% 17.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122649502 T -> A LOC_Os11g38200.1 upstream_gene_variant ; 2289.0bp to feature; MODIFIER silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N
vg1122649502 T -> A LOC_Os11g38210.1 upstream_gene_variant ; 283.0bp to feature; MODIFIER silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N
vg1122649502 T -> A LOC_Os11g38220.1 upstream_gene_variant ; 1994.0bp to feature; MODIFIER silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N
vg1122649502 T -> A LOC_Os11g38230.1 downstream_gene_variant ; 4637.0bp to feature; MODIFIER silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N
vg1122649502 T -> A LOC_Os11g38200-LOC_Os11g38210 intergenic_region ; MODIFIER silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N
vg1122649502 T -> DEL N N silent_mutation Average:62.545; most accessible tissue: Callus, score: 91.586 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122649502 NA 1.82E-06 mr1705 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502 NA 5.21E-07 mr1800 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502 NA 1.12E-06 mr1180_2 Ind_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502 1.87E-07 6.94E-06 mr1748_2 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502 NA 5.27E-09 mr1850_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251