Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122649502:

Variant ID: vg1122649502 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22649502
Reference Allele: T	Alternative Allele: A
Primary Allele: T	Secondary Allele: A

Inferred Ancestral Allele : T (evidence from allele frequency in Oryza rufipogon: T: 0.96, A: 0.04, others allele: 0.00, population size: 218. )

Flanking Sequence (100 bp) in Reference Genome:

CATAGATTCGCATATGCTTCCTTGACATCTCCACAGAAACAAGGCTACAATAGCACAATGGTGATATTGCCAGAGATGACCAGATTGACCTTGTAGTGCT[T/A]
TGCCTGAAGAGCAGTGAGACAGAGTGACTTGGTCCAAGATGTTAGGCTCTGTACCCCAGGACAGAACCAAGTCAAGAAAAAATTATCACAACAAATTTTT

Reverse complement sequence

AAAAATTTGTTGTGATAATTTTTTCTTGACTTGGTTCTGTCCTGGGGTACAGAGCCTAACATCTTGGACCAAGTCACTCTGTCTCACTGCTCTTCAGGCA[A/T]
AGCACTACAAGGTCAATCTGGTCATCTCTGGCAATATCACCATTGTGCTATTGTAGCCTTGTTTCTGTGGAGATGTCAAGGAAGCATATGCGAATCTATG

Allele Frequencies:

Populations	Population Size	Frequency of T(primary allele)	Frequency of A(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	83.70%	15.90%	0.02%	0.38%	NA
All Indica	2759	83.50%	16.20%	0.00%	0.33%	NA
All Japonica	1512	93.50%	5.90%	0.00%	0.60%	NA
Aus	269	30.50%	69.10%	0.37%	0.00%	NA
Indica I	595	95.00%	4.70%	0.00%	0.34%	NA
Indica II	465	96.60%	3.40%	0.00%	0.00%	NA
Indica III	913	66.60%	32.70%	0.00%	0.66%	NA
Indica Intermediate	786	86.80%	13.10%	0.00%	0.13%	NA
Temperate Japonica	767	97.00%	3.00%	0.00%	0.00%	NA
Tropical Japonica	504	87.10%	11.30%	0.00%	1.59%	NA
Japonica Intermediate	241	95.90%	3.70%	0.00%	0.41%	NA
VI/Aromatic	96	85.40%	14.60%	0.00%	0.00%	NA
Intermediate	90	82.20%	17.80%	0.00%	0.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122649502	T -> A	LOC_Os11g38200.1	upstream_gene_variant ; 2289.0bp to feature; MODIFIER	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N
vg1122649502	T -> A	LOC_Os11g38210.1	upstream_gene_variant ; 283.0bp to feature; MODIFIER	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N
vg1122649502	T -> A	LOC_Os11g38220.1	upstream_gene_variant ; 1994.0bp to feature; MODIFIER	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N
vg1122649502	T -> A	LOC_Os11g38230.1	downstream_gene_variant ; 4637.0bp to feature; MODIFIER	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N
vg1122649502	T -> A	LOC_Os11g38200-LOC_Os11g38210	intergenic_region ; MODIFIER	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N
vg1122649502	T -> DEL	N	N	silent_mutation	Average:62.545; most accessible tissue: Callus, score: 91.586	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122649502	NA	1.82E-06	mr1705	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502	NA	5.21E-07	mr1800	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502	NA	1.12E-06	mr1180_2	Ind_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502	1.87E-07	6.94E-06	mr1748_2	Jap_All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122649502	NA	5.27E-09	mr1850_2	Jap_All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251