Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122647736:

Variant ID: vg1122647736 (JBrowse)	Variation Type: SNP
Chromosome: chr11	Position: 22647736
Reference Allele: T	Alternative Allele: C
Primary Allele: C	Secondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:

ATGAGAATAAAATTTGGACTTTAGTGGTTCCACATTTTTAACCAATATAAAGTAATATCTTATCAAGTGATGACTGATTGCAGTTGGGTCAAGTAATATC[T/C]
CAAGCAATGAATCAAATATTATTGGACAAGCGATGACTGATTACAATTGGAGAAGTTTGTTAGCTATTGAAGTAGTCACAGAAATATTCTAGCCAAAAAG

Reverse complement sequence

CTTTTTGGCTAGAATATTTCTGTGACTACTTCAATAGCTAACAAACTTCTCCAATTGTAATCAGTCATCGCTTGTCCAATAATATTTGATTCATTGCTTG[A/G]
GATATTACTTGACCCAACTGCAATCAGTCATCACTTGATAAGATATTACTTTATATTGGTTAAAAATGTGGAACCACTAAAGTCCAAATTTTATTCTCAT

Allele Frequencies:

Populations	Population Size	Frequency of C(primary allele)	Frequency of T(secondary allele)	Frequency of N	Frequency of DEL	Frequency of others Allele
All	4726	32.40%	12.70%	2.24%	52.64%	NA
All Indica	2759	13.10%	9.10%	1.85%	75.90%	NA
All Japonica	1512	74.10%	15.70%	2.12%	8.00%	NA
Aus	269	10.00%	7.40%	3.72%	78.81%	NA
Indica I	595	11.60%	12.30%	2.35%	73.78%	NA
Indica II	465	4.50%	15.50%	0.43%	79.57%	NA
Indica III	913	21.00%	1.60%	0.77%	76.56%	NA
Indica Intermediate	786	10.20%	11.70%	3.56%	74.55%	NA
Temperate Japonica	767	64.50%	27.50%	2.74%	5.22%	NA
Tropical Japonica	504	85.90%	0.60%	0.99%	12.50%	NA
Japonica Intermediate	241	80.10%	10.00%	2.49%	7.47%	NA
VI/Aromatic	96	2.10%	72.90%	8.33%	16.67%	NA
Intermediate	90	22.20%	22.20%	5.56%	50.00%	NA

Allele Effect:

Var ID	Var	Locus	snpEff Annotation	CooVar Annotation	Chromatin Accessibility Score	PolyPhen-2 Effect	PolyPhen-2 Score	SIFT Effect	SIFT Score
vg1122647736	T -> DEL	N	N	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N
vg1122647736	T -> C	LOC_Os11g38190.1	upstream_gene_variant ; 3754.0bp to feature; MODIFIER	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N
vg1122647736	T -> C	LOC_Os11g38200.1	upstream_gene_variant ; 523.0bp to feature; MODIFIER	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N
vg1122647736	T -> C	LOC_Os11g38210.1	upstream_gene_variant ; 2049.0bp to feature; MODIFIER	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N
vg1122647736	T -> C	LOC_Os11g38220.1	upstream_gene_variant ; 3760.0bp to feature; MODIFIER	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N
vg1122647736	T -> C	LOC_Os11g38200-LOC_Os11g38210	intergenic_region ; MODIFIER	silent_mutation	Average:23.619; most accessible tissue: Callus, score: 79.165	N	N	N	N

Putative Genotype-Phenotype Associations:

Var ID	LMM P-value	LR P-value	Trait	Subpopulation	Is leadSNP	Publication
vg1122647736	1.10E-07	7.01E-32	mr1238	All	YES	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	2.68E-06	4.26E-31	mr1309	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	3.55E-06	9.53E-20	mr1484	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	5.90E-06	mr1577	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	2.69E-19	mr1627	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.03E-24	mr1888	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	5.74E-14	mr1900	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	1.01E-11	mr1949	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.21E-09	mr1084_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	8.21E-06	mr1153_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	9.51E-55	mr1194_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	1.42E-08	mr1205_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.57E-29	mr1238_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	1.65E-06	mr1275_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	5.62E-08	mr1418_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	2.23E-27	mr1484_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	5.47E-07	mr1488_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	2.84E-10	mr1506_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.54E-07	mr1604_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	8.70E-11	mr1646_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	1.73E-13	mr1714_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.58E-11	mr1806_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	4.98E-20	mr1900_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	3.07E-12	mr1986_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736	NA	1.07E-06	mr1992_2	All	Not	Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251