\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122647736:

Variant ID: vg1122647736 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22647736
Reference Allele: TAlternative Allele: C
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


ATGAGAATAAAATTTGGACTTTAGTGGTTCCACATTTTTAACCAATATAAAGTAATATCTTATCAAGTGATGACTGATTGCAGTTGGGTCAAGTAATATC[T/C]
CAAGCAATGAATCAAATATTATTGGACAAGCGATGACTGATTACAATTGGAGAAGTTTGTTAGCTATTGAAGTAGTCACAGAAATATTCTAGCCAAAAAG

Reverse complement sequence

CTTTTTGGCTAGAATATTTCTGTGACTACTTCAATAGCTAACAAACTTCTCCAATTGTAATCAGTCATCGCTTGTCCAATAATATTTGATTCATTGCTTG[A/G]
GATATTACTTGACCCAACTGCAATCAGTCATCACTTGATAAGATATTACTTTATATTGGTTAAAAATGTGGAACCACTAAAGTCCAAATTTTATTCTCAT

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 32.40% 12.70% 2.24% 52.64% NA
All Indica  2759 13.10% 9.10% 1.85% 75.90% NA
All Japonica  1512 74.10% 15.70% 2.12% 8.00% NA
Aus  269 10.00% 7.40% 3.72% 78.81% NA
Indica I  595 11.60% 12.30% 2.35% 73.78% NA
Indica II  465 4.50% 15.50% 0.43% 79.57% NA
Indica III  913 21.00% 1.60% 0.77% 76.56% NA
Indica Intermediate  786 10.20% 11.70% 3.56% 74.55% NA
Temperate Japonica  767 64.50% 27.50% 2.74% 5.22% NA
Tropical Japonica  504 85.90% 0.60% 0.99% 12.50% NA
Japonica Intermediate  241 80.10% 10.00% 2.49% 7.47% NA
VI/Aromatic  96 2.10% 72.90% 8.33% 16.67% NA
Intermediate  90 22.20% 22.20% 5.56% 50.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122647736 T -> DEL N N silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N
vg1122647736 T -> C LOC_Os11g38190.1 upstream_gene_variant ; 3754.0bp to feature; MODIFIER silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N
vg1122647736 T -> C LOC_Os11g38200.1 upstream_gene_variant ; 523.0bp to feature; MODIFIER silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N
vg1122647736 T -> C LOC_Os11g38210.1 upstream_gene_variant ; 2049.0bp to feature; MODIFIER silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N
vg1122647736 T -> C LOC_Os11g38220.1 upstream_gene_variant ; 3760.0bp to feature; MODIFIER silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N
vg1122647736 T -> C LOC_Os11g38200-LOC_Os11g38210 intergenic_region ; MODIFIER silent_mutation Average:23.619; most accessible tissue: Callus, score: 79.165 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122647736 1.10E-07 7.01E-32 mr1238 All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 2.68E-06 4.26E-31 mr1309 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 3.55E-06 9.53E-20 mr1484 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 5.90E-06 mr1577 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 2.69E-19 mr1627 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.03E-24 mr1888 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 5.74E-14 mr1900 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 1.01E-11 mr1949 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.21E-09 mr1084_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 8.21E-06 mr1153_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 9.51E-55 mr1194_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 1.42E-08 mr1205_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.57E-29 mr1238_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 1.65E-06 mr1275_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 5.62E-08 mr1418_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 2.23E-27 mr1484_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 5.47E-07 mr1488_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 2.84E-10 mr1506_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.54E-07 mr1604_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 8.70E-11 mr1646_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 1.73E-13 mr1714_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.58E-11 mr1806_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 4.98E-20 mr1900_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 3.07E-12 mr1986_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122647736 NA 1.07E-06 mr1992_2 All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251