\
| Variant ID: vg1122629035 (JBrowse) | Variation Type: SNP |
| Chromosome: chr11 | Position: 22629035 |
| Reference Allele: C | Alternative Allele: T |
| Primary Allele: C | Secondary Allele: T |
Inferred Ancestral Allele: Not determined.
CGTGGGATCCGCGAAGAAGAATCAACCAATCTTCTTCTTGCATGCATGCATAACAAATACTTTATCCATATTTTAATATATGACACCGTTGACTTTTTAA[C/T]
AAACGTATGACCTTTTGTCTTATTCAAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTTGATTTATCATCAAATGTTCTTTAAACGTGACATA
TATGTCACGTTTAAAGAACATTTGATGATAAATCAAAGTCACAATAAAATAAATGATAATTACATAAATTTTTTTGAATAAGACAAAAGGTCATACGTTT[G/A]
TTAAAAAGTCAACGGTGTCATATATTAAAATATGGATAAAGTATTTGTTATGCATGCATGCAAGAAGAAGATTGGTTGATTCTTCTTCGCGGATCCCACG
| Populations | Population Size | Frequency of C(primary allele) | Frequency of T(secondary allele) | Frequency of N | Frequency of DEL | Frequency of others Allele |
|---|---|---|---|---|---|---|
| All | 4726 | 89.80% | 10.20% | 0.02% | 0.00% | NA |
| All Indica | 2759 | 88.00% | 12.00% | 0.00% | 0.00% | NA |
| All Japonica | 1512 | 93.00% | 7.00% | 0.00% | 0.00% | NA |
| Aus | 269 | 90.30% | 9.70% | 0.00% | 0.00% | NA |
| Indica I | 595 | 87.90% | 12.10% | 0.00% | 0.00% | NA |
| Indica II | 465 | 96.30% | 3.70% | 0.00% | 0.00% | NA |
| Indica III | 913 | 81.30% | 18.70% | 0.00% | 0.00% | NA |
| Indica Intermediate | 786 | 90.80% | 9.20% | 0.00% | 0.00% | NA |
| Temperate Japonica | 767 | 97.00% | 3.00% | 0.00% | 0.00% | NA |
| Tropical Japonica | 504 | 92.10% | 7.90% | 0.00% | 0.00% | NA |
| Japonica Intermediate | 241 | 82.20% | 17.80% | 0.00% | 0.00% | NA |
| VI/Aromatic | 96 | 89.60% | 9.40% | 1.04% | 0.00% | NA |
| Intermediate | 90 | 92.20% | 7.80% | 0.00% | 0.00% | NA |
| Var ID | Var | Locus | snpEff Annotation | CooVar Annotation | Chromatin Accessibility Score | PolyPhen-2 Effect | PolyPhen-2 Score | SIFT Effect | SIFT Score |
|---|---|---|---|---|---|---|---|---|---|
| vg1122629035 | C -> T | LOC_Os11g38150.1 | upstream_gene_variant ; 4684.0bp to feature; MODIFIER | silent_mutation | Average:37.689; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg1122629035 | C -> T | LOC_Os11g38170.1 | upstream_gene_variant ; 1940.0bp to feature; MODIFIER | silent_mutation | Average:37.689; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg1122629035 | C -> T | LOC_Os11g38170.2 | upstream_gene_variant ; 1940.0bp to feature; MODIFIER | silent_mutation | Average:37.689; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg1122629035 | C -> T | LOC_Os11g38160.1 | downstream_gene_variant ; 1456.0bp to feature; MODIFIER | silent_mutation | Average:37.689; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| vg1122629035 | C -> T | LOC_Os11g38160-LOC_Os11g38170 | intergenic_region ; MODIFIER | silent_mutation | Average:37.689; most accessible tissue: Callus, score: 84.269 | N | N | N | N |
| Var ID | LMM P-value | LR P-value | Trait | Subpopulation | Is leadSNP | Publication |
|---|---|---|---|---|---|---|
| vg1122629035 | NA | 8.70E-06 | mr1071 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 3.46E-06 | mr1100 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 2.90E-07 | mr1140 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 1.12E-06 | mr1395 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | 5.90E-06 | 6.02E-09 | mr1613 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 2.25E-06 | mr1618 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 1.00E-06 | mr1619 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | 1.60E-06 | 5.50E-10 | mr1913 | Jap_All | YES | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 6.38E-08 | mr1071_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 6.92E-07 | mr1080_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 5.50E-09 | mr1203_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 9.68E-09 | mr1613_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 2.35E-06 | mr1795_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |
| vg1122629035 | NA | 1.27E-06 | mr1913_2 | Jap_All | Not | Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251 |