\

Search for Variation information by Variation ID:

Please input a variation ID (e.g., vg0722097923 , STR0500036000 ).

Detailed information for vg1122629035:

Variant ID: vg1122629035 (JBrowse)Variation Type: SNP
Chromosome: chr11Position: 22629035
Reference Allele: CAlternative Allele: T
Primary Allele: CSecondary Allele: T

Inferred Ancestral Allele: Not determined.

Flanking Sequence (100 bp) in Reference Genome:


CGTGGGATCCGCGAAGAAGAATCAACCAATCTTCTTCTTGCATGCATGCATAACAAATACTTTATCCATATTTTAATATATGACACCGTTGACTTTTTAA[C/T]
AAACGTATGACCTTTTGTCTTATTCAAAAAAATTTATGTAATTATCATTTATTTTATTGTGACTTTGATTTATCATCAAATGTTCTTTAAACGTGACATA

Reverse complement sequence

TATGTCACGTTTAAAGAACATTTGATGATAAATCAAAGTCACAATAAAATAAATGATAATTACATAAATTTTTTTGAATAAGACAAAAGGTCATACGTTT[G/A]
TTAAAAAGTCAACGGTGTCATATATTAAAATATGGATAAAGTATTTGTTATGCATGCATGCAAGAAGAAGATTGGTTGATTCTTCTTCGCGGATCCCACG

Allele Frequencies:

Populations Population SizeFrequency of C(primary allele) Frequency of T(secondary allele) Frequency of N Frequency of DEL Frequency of others Allele
All  4726 89.80% 10.20% 0.02% 0.00% NA
All Indica  2759 88.00% 12.00% 0.00% 0.00% NA
All Japonica  1512 93.00% 7.00% 0.00% 0.00% NA
Aus  269 90.30% 9.70% 0.00% 0.00% NA
Indica I  595 87.90% 12.10% 0.00% 0.00% NA
Indica II  465 96.30% 3.70% 0.00% 0.00% NA
Indica III  913 81.30% 18.70% 0.00% 0.00% NA
Indica Intermediate  786 90.80% 9.20% 0.00% 0.00% NA
Temperate Japonica  767 97.00% 3.00% 0.00% 0.00% NA
Tropical Japonica  504 92.10% 7.90% 0.00% 0.00% NA
Japonica Intermediate  241 82.20% 17.80% 0.00% 0.00% NA
VI/Aromatic  96 89.60% 9.40% 1.04% 0.00% NA
Intermediate  90 92.20% 7.80% 0.00% 0.00% NA

Allele Effect:

Var ID Var Locus snpEff Annotation CooVar Annotation Chromatin Accessibility Score PolyPhen-2 Effect PolyPhen-2 Score SIFT Effect SIFT Score
vg1122629035 C -> T LOC_Os11g38150.1 upstream_gene_variant ; 4684.0bp to feature; MODIFIER silent_mutation Average:37.689; most accessible tissue: Callus, score: 84.269 N N N N
vg1122629035 C -> T LOC_Os11g38170.1 upstream_gene_variant ; 1940.0bp to feature; MODIFIER silent_mutation Average:37.689; most accessible tissue: Callus, score: 84.269 N N N N
vg1122629035 C -> T LOC_Os11g38170.2 upstream_gene_variant ; 1940.0bp to feature; MODIFIER silent_mutation Average:37.689; most accessible tissue: Callus, score: 84.269 N N N N
vg1122629035 C -> T LOC_Os11g38160.1 downstream_gene_variant ; 1456.0bp to feature; MODIFIER silent_mutation Average:37.689; most accessible tissue: Callus, score: 84.269 N N N N
vg1122629035 C -> T LOC_Os11g38160-LOC_Os11g38170 intergenic_region ; MODIFIER silent_mutation Average:37.689; most accessible tissue: Callus, score: 84.269 N N N N

Putative Genotype-Phenotype Associations:

Var ID LMM P-value LR P-value Trait Subpopulation Is leadSNP Publication
vg1122629035 NA 8.70E-06 mr1071 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 3.46E-06 mr1100 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 2.90E-07 mr1140 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 1.12E-06 mr1395 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 5.90E-06 6.02E-09 mr1613 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 2.25E-06 mr1618 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 1.00E-06 mr1619 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 1.60E-06 5.50E-10 mr1913 Jap_All YES Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 6.38E-08 mr1071_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 6.92E-07 mr1080_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 5.50E-09 mr1203_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 9.68E-09 mr1613_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 2.35E-06 mr1795_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251
vg1122629035 NA 1.27E-06 mr1913_2 Jap_All Not Genome-wide association analyses provide genetic and biochemical insights into natural variation in rice metabolism, Nat Genet, 46(7):714-21, PMID:24908251